\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317749929:

Variant ID: vg0317749929 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17749929
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTCTTCATCATGATATGGGTCCCACGTGTTATTGGCACGTAAAAGCGTGACAAGTAGGGGTGAAAACGGGTCATCTCACCCTTCCCATATCCTAACCC[A/G]
TATTTTATAATCGGAATTGGGTCGGACACAAATAGTGTCGAATACGGATACAAACTCAGATAATGTCGGGCAAAAATACGAAACGAATACGTACCAAAAT

Reverse complement sequence

ATTTTGGTACGTATTCGTTTCGTATTTTTGCCCGACATTATCTGAGTTTGTATCCGTATTCGACACTATTTGTGTCCGACCCAATTCCGATTATAAAATA[T/C]
GGGTTAGGATATGGGAAGGGTGAGATGACCCGTTTTCACCCCTACTTGTCACGCTTTTACGTGCCAATAACACGTGGGACCCATATCATGATGAAGAAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 6.90% 0.02% 0.00% NA
All Indica  2759 88.40% 11.60% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 61.00% 38.80% 0.17% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 91.20% 8.80% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317749929 A -> G LOC_Os03g31170.1 upstream_gene_variant ; 1368.0bp to feature; MODIFIER silent_mutation Average:75.037; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0317749929 A -> G LOC_Os03g31180.1 upstream_gene_variant ; 4889.0bp to feature; MODIFIER silent_mutation Average:75.037; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0317749929 A -> G LOC_Os03g31170.3 upstream_gene_variant ; 1368.0bp to feature; MODIFIER silent_mutation Average:75.037; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0317749929 A -> G LOC_Os03g31170.2 upstream_gene_variant ; 1368.0bp to feature; MODIFIER silent_mutation Average:75.037; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0317749929 A -> G LOC_Os03g31180.2 upstream_gene_variant ; 4888.0bp to feature; MODIFIER silent_mutation Average:75.037; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0317749929 A -> G LOC_Os03g31170-LOC_Os03g31180 intergenic_region ; MODIFIER silent_mutation Average:75.037; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0317749929 A G 0.02 0.02 0.02 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317749929 NA 4.65E-11 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317749929 NA 2.75E-08 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317749929 NA 2.58E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317749929 NA 1.09E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317749929 NA 7.82E-06 mr1092 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317749929 NA 8.00E-07 mr1097 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317749929 NA 3.81E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317749929 NA 8.82E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317749929 NA 4.53E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317749929 NA 9.11E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317749929 NA 3.43E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317749929 NA 7.88E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317749929 NA 3.65E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317749929 NA 6.25E-07 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251