\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317737568:

Variant ID: vg0317737568 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17737568
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.03, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


ATGCATAGAGCATTAAATGTGGACGAGAAGAAAACCAATTACACAATTTGTATGTAAATTATAAGATGAATCTTTTGAGCCTAATTACACCATGATTTGA[C/T]
AATATGGTGCTACAGTAAACATTTGCTAATGACGGATTAATTAGGTTTAATAGATTTGTCCCGCAGTTTACAGACAGAATCTATAATTTGTTTTATTATT

Reverse complement sequence

AATAATAAAACAAATTATAGATTCTGTCTGTAAACTGCGGGACAAATCTATTAAACCTAATTAATCCGTCATTAGCAAATGTTTACTGTAGCACCATATT[G/A]
TCAAATCATGGTGTAATTAGGCTCAAAAGATTCATCTTATAATTTACATACAAATTGTGTAATTGGTTTTCTTCTCGTCCACATTTAATGCTCTATGCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 43.10% 0.02% 0.30% NA
All Indica  2759 94.00% 5.70% 0.00% 0.33% NA
All Japonica  1512 0.50% 99.30% 0.07% 0.07% NA
Aus  269 10.80% 89.20% 0.00% 0.00% NA
Indica I  595 95.50% 4.00% 0.00% 0.50% NA
Indica II  465 96.30% 3.20% 0.00% 0.43% NA
Indica III  913 96.80% 3.10% 0.00% 0.11% NA
Indica Intermediate  786 88.20% 11.50% 0.00% 0.38% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.20% 0.20% 0.20% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 44.40% 51.10% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317737568 C -> T LOC_Os03g31150.1 upstream_gene_variant ; 498.0bp to feature; MODIFIER silent_mutation Average:52.168; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0317737568 C -> T LOC_Os03g31160.1 upstream_gene_variant ; 4487.0bp to feature; MODIFIER silent_mutation Average:52.168; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0317737568 C -> T LOC_Os03g31150.3 upstream_gene_variant ; 513.0bp to feature; MODIFIER silent_mutation Average:52.168; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0317737568 C -> T LOC_Os03g31150.2 upstream_gene_variant ; 513.0bp to feature; MODIFIER silent_mutation Average:52.168; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0317737568 C -> T LOC_Os03g31160.2 upstream_gene_variant ; 4487.0bp to feature; MODIFIER silent_mutation Average:52.168; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0317737568 C -> T LOC_Os03g31134.1 downstream_gene_variant ; 2717.0bp to feature; MODIFIER silent_mutation Average:52.168; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0317737568 C -> T LOC_Os03g31134-LOC_Os03g31150 intergenic_region ; MODIFIER silent_mutation Average:52.168; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N
vg0317737568 C -> DEL N N silent_mutation Average:52.168; most accessible tissue: Zhenshan97 root, score: 70.636 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317737568 NA 2.71E-28 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 2.98E-47 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 1.91E-32 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 1.45E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 6.64E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 5.84E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 1.21E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 5.77E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 6.22E-84 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 4.35E-06 5.71E-11 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 2.68E-07 1.09E-18 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 1.28E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 1.10E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 1.14E-11 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 3.77E-32 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 2.20E-59 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 5.03E-36 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 6.31E-37 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 1.28E-21 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 7.60E-30 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 8.35E-23 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 1.70E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 3.64E-37 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 7.63E-24 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 1.30E-07 5.72E-108 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 2.04E-07 1.36E-15 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 3.33E-51 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 2.81E-40 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 8.08E-09 1.95E-28 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 4.51E-68 mr1798_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317737568 NA 2.44E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251