\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317721273:

Variant ID: vg0317721273 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17721273
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, A: 0.20, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GACTTGTGCAATGATTTCTTCAAATTTTTGCTCCCGTGCTTCTGATGCTCTTACATACTTCACACTTTCCCTTATCCTGGATATGGCAGCACTGATAGTA[C/A]
TCAATCCATCTTGAACAATAGGATTAAAGATGTGAGCTGCGCACCAGAAATGAAATAGCTCTCCTTTGCAAGGCATAGCAAGTTTACCCAAGAGATTTCC

Reverse complement sequence

GGAAATCTCTTGGGTAAACTTGCTATGCCTTGCAAAGGAGAGCTATTTCATTTCTGGTGCGCAGCTCACATCTTTAATCCTATTGTTCAAGATGGATTGA[G/T]
TACTATCAGTGCTGCCATATCCAGGATAAGGGAAAGTGTGAAGTATGTAAGAGCATCAGAAGCACGGGAGCAAAAATTTGAAGAAATCATTGCACAAGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 35.50% 0.00% 0.30% NA
All Indica  2759 97.80% 1.90% 0.00% 0.29% NA
All Japonica  1512 1.10% 98.70% 0.00% 0.13% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 98.20% 1.50% 0.00% 0.34% NA
Indica II  465 97.00% 2.60% 0.00% 0.43% NA
Indica III  913 98.60% 1.30% 0.00% 0.11% NA
Indica Intermediate  786 97.10% 2.50% 0.00% 0.38% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 96.80% 0.00% 0.40% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 47.80% 47.80% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317721273 C -> A LOC_Os03g31110.1 missense_variant ; p.Ser180Ile; MODERATE nonsynonymous_codon ; S180I Average:50.459; most accessible tissue: Minghui63 flower, score: 62.076 possibly damaging 1.987 DELETERIOUS 0.01
vg0317721273 C -> A LOC_Os03g31110.2 missense_variant ; p.Ser180Ile; MODERATE nonsynonymous_codon ; S180I Average:50.459; most accessible tissue: Minghui63 flower, score: 62.076 probably damaging 2.001 DELETERIOUS 0.01
vg0317721273 C -> DEL LOC_Os03g31110.1 N frameshift_variant Average:50.459; most accessible tissue: Minghui63 flower, score: 62.076 N N N N
vg0317721273 C -> DEL LOC_Os03g31110.2 N frameshift_variant Average:50.459; most accessible tissue: Minghui63 flower, score: 62.076 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317721273 2.21E-13 9.74E-96 mr1718 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 1.66E-20 4.71E-168 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 NA 3.40E-17 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 NA 6.18E-40 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 NA 6.28E-54 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 NA 1.99E-70 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 NA 8.67E-79 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 NA 5.32E-51 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 1.12E-08 9.61E-123 mr1987 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 NA 1.47E-19 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 NA 2.29E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 NA 9.98E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 NA 2.27E-77 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 NA 1.09E-37 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 NA 1.09E-12 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 8.95E-18 1.63E-141 mr1718_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 4.84E-28 7.74E-234 mr1750_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 NA 1.32E-65 mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 NA 1.26E-15 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317721273 2.58E-09 5.05E-166 mr1987_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251