\
| Variant ID: vg0317664128 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17664128 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATGTATGTACATCTTTGACAATATTATAAAAAATAGTATAATTTAAAATGACACCAATCTGAACAGCCCGTTAGTTCTTTTTGGGTTTGTTTTTGGGTGT[G/C]
TGCAGCAGACTGTCTATGAATGCATTTCGTCCTTTTGGTCTGAAAAACAATAGCTGCACAGATATAAGTTAAGCTTGCTTCCGGAAGTTAGTGACTTATA
TATAAGTCACTAACTTCCGGAAGCAAGCTTAACTTATATCTGTGCAGCTATTGTTTTTCAGACCAAAAGGACGAAATGCATTCATAGACAGTCTGCTGCA[C/G]
ACACCCAAAAACAAACCCAAAAAGAACTAACGGGCTGTTCAGATTGGTGTCATTTTAAATTATACTATTTTTTATAATATTGTCAAAGATGTACATACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 42.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317664128 | G -> C | LOC_Os03g31000.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.53; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317664128 | NA | 2.44E-11 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317664128 | NA | 7.04E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317664128 | NA | 1.09E-07 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317664128 | NA | 3.18E-13 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317664128 | NA | 3.15E-07 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317664128 | 1.16E-09 | NA | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317664128 | 7.56E-09 | 1.15E-13 | mr1750_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |