\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317581872:

Variant ID: vg0317581872 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17581872
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAAATAAGCATCAACATTTACATAGTAACGTAATGCTGCTATTACGAAGAGTATTAACAAAGAAACATCTAATAGAATCGGGAGAATGAAAGTATACC[T/C]
CGAGAACGTCCCACCGCTGGATTTTGAGGCAGTATTGCCTCCGTTGATGTCATTCATCGTCTTGTCTCCAATCTCCGTCGACATCTTGATGAAGGCGTCG

Reverse complement sequence

CGACGCCTTCATCAAGATGTCGACGGAGATTGGAGACAAGACGATGAATGACATCAACGGAGGCAATACTGCCTCAAAATCCAGCGGTGGGACGTTCTCG[A/G]
GGTATACTTTCATTCTCCCGATTCTATTAGATGTTTCTTTGTTAATACTCTTCGTAATAGCAGCATTACGTTACTATGTAAATGTTGATGCTTATTTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 32.00% 0.04% 0.00% NA
All Indica  2759 98.10% 1.90% 0.04% 0.00% NA
All Japonica  1512 7.80% 92.20% 0.00% 0.00% NA
Aus  269 91.80% 8.20% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 2.70% 0.13% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 20.20% 79.80% 0.00% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317581872 T -> C LOC_Os03g30860.1 upstream_gene_variant ; 1511.0bp to feature; MODIFIER silent_mutation Average:39.396; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0317581872 T -> C LOC_Os03g30840.1 downstream_gene_variant ; 4695.0bp to feature; MODIFIER silent_mutation Average:39.396; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0317581872 T -> C LOC_Os03g30850.1 downstream_gene_variant ; 416.0bp to feature; MODIFIER silent_mutation Average:39.396; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0317581872 T -> C LOC_Os03g30850-LOC_Os03g30860 intergenic_region ; MODIFIER silent_mutation Average:39.396; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317581872 NA 1.60E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317581872 8.47E-07 4.25E-10 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317581872 NA 3.60E-35 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317581872 NA 5.27E-10 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317581872 1.52E-10 3.38E-114 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317581872 3.67E-14 6.48E-28 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317581872 4.21E-06 NA mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317581872 1.71E-10 1.70E-10 mr1987 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317581872 NA 1.38E-13 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317581872 1.27E-06 NA mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317581872 8.24E-07 3.37E-17 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317581872 7.61E-06 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317581872 8.08E-07 3.22E-29 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317581872 NA 2.19E-65 mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317581872 NA 9.10E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251