Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317523208:

Variant ID: vg0317523208 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17523208
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCATAAGAAGCAATGAATATGATGGGGTTCTATTTTTCACTAAGGTAATGATATTAGTTCTAAGGTATTATTTTGGTCGACTTTATTTCTCAATAATTAC[T/C]
AAACATGTTAAATTTAATATATGGATGTATTTATTTTCGTTTTGCAAGTAAAATTAGCGTCTATATATATCACAAAATTTTTTATATAGTTTAGAGAGCC

Reverse complement sequence

GGCTCTCTAAACTATATAAAAAATTTTGTGATATATATAGACGCTAATTTTACTTGCAAAACGAAAATAAATACATCCATATATTAAATTTAACATGTTT[A/G]
GTAATTATTGAGAAATAAAGTCGACCAAAATAATACCTTAGAACTAATATCATTACCTTAGTGAAAAATAGAACCCCATCATATTCATTGCTTCTTATGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.00%	31.80%	0.17%	0.00%	NA
All Indica	2759	98.00%	1.80%	0.18%	0.00%	NA
All Japonica	1512	8.30%	91.70%	0.00%	0.00%	NA
Aus	269	90.30%	9.70%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	98.10%	1.70%	0.22%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	96.80%	2.70%	0.51%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	21.60%	78.40%	0.00%	0.00%	NA
Japonica Intermediate	241	5.80%	94.20%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	61.10%	35.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317523208	T -> C	LOC_Os03g30740.1	upstream_gene_variant ; 1292.0bp to feature; MODIFIER	silent_mutation	Average:30.677; most accessible tissue: Callus, score: 44.047	N	N	N	N
vg0317523208	T -> C	LOC_Os03g30744.1	downstream_gene_variant ; 1008.0bp to feature; MODIFIER	silent_mutation	Average:30.677; most accessible tissue: Callus, score: 44.047	N	N	N	N
vg0317523208	T -> C	LOC_Os03g30750.1	downstream_gene_variant ; 552.0bp to feature; MODIFIER	silent_mutation	Average:30.677; most accessible tissue: Callus, score: 44.047	N	N	N	N
vg0317523208	T -> C	LOC_Os03g30744-LOC_Os03g30750	intergenic_region ; MODIFIER	silent_mutation	Average:30.677; most accessible tissue: Callus, score: 44.047	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317523208	NA	5.74E-20	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	2.76E-42	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	1.34E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	7.56E-38	mr1350	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	1.72E-20	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	3.14E-52	mr1136_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	2.37E-40	mr1243_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	1.27E-36	mr1251_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	1.04E-20	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	1.92E-25	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	2.44E-13	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	2.16E-28	mr1423_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	8.09E-37	mr1435_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	6.83E-34	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	1.62E-58	mr1599_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	7.33E-06	NA	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208	NA	4.52E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251