\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317523208:

Variant ID: vg0317523208 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17523208
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATAAGAAGCAATGAATATGATGGGGTTCTATTTTTCACTAAGGTAATGATATTAGTTCTAAGGTATTATTTTGGTCGACTTTATTTCTCAATAATTAC[T/C]
AAACATGTTAAATTTAATATATGGATGTATTTATTTTCGTTTTGCAAGTAAAATTAGCGTCTATATATATCACAAAATTTTTTATATAGTTTAGAGAGCC

Reverse complement sequence

GGCTCTCTAAACTATATAAAAAATTTTGTGATATATATAGACGCTAATTTTACTTGCAAAACGAAAATAAATACATCCATATATTAAATTTAACATGTTT[A/G]
GTAATTATTGAGAAATAAAGTCGACCAAAATAATACCTTAGAACTAATATCATTACCTTAGTGAAAAATAGAACCCCATCATATTCATTGCTTCTTATGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 31.80% 0.17% 0.00% NA
All Indica  2759 98.00% 1.80% 0.18% 0.00% NA
All Japonica  1512 8.30% 91.70% 0.00% 0.00% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 96.80% 2.70% 0.51% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 21.60% 78.40% 0.00% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 61.10% 35.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317523208 T -> C LOC_Os03g30740.1 upstream_gene_variant ; 1292.0bp to feature; MODIFIER silent_mutation Average:30.677; most accessible tissue: Callus, score: 44.047 N N N N
vg0317523208 T -> C LOC_Os03g30744.1 downstream_gene_variant ; 1008.0bp to feature; MODIFIER silent_mutation Average:30.677; most accessible tissue: Callus, score: 44.047 N N N N
vg0317523208 T -> C LOC_Os03g30750.1 downstream_gene_variant ; 552.0bp to feature; MODIFIER silent_mutation Average:30.677; most accessible tissue: Callus, score: 44.047 N N N N
vg0317523208 T -> C LOC_Os03g30744-LOC_Os03g30750 intergenic_region ; MODIFIER silent_mutation Average:30.677; most accessible tissue: Callus, score: 44.047 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317523208 NA 5.74E-20 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 2.76E-42 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 1.34E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 7.56E-38 mr1350 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 1.72E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 3.14E-52 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 2.37E-40 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 1.27E-36 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 1.04E-20 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 1.92E-25 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 2.44E-13 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 2.16E-28 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 8.09E-37 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 6.83E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 1.62E-58 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 7.33E-06 NA mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317523208 NA 4.52E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251