\
| Variant ID: vg0317492428 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17492428 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTCGCTATTTAATTAGGCAACATTAGGTGGTTTTACAACTCTAGACTTTGGGAATATTCATATTGCTTGGACATTATGGAATGGTTGGATTATTGTGGAA[C/T]
TGGATTCACACCTCCCCCTCTATTCAAAACCCTCAAAATGGTTTTAGGCTGGGCTCGGGGTGCATGGTTTTGATAGTAGCACCTCGGCCACATAAGGACC
GGTCCTTATGTGGCCGAGGTGCTACTATCAAAACCATGCACCCCGAGCCCAGCCTAAAACCATTTTGAGGGTTTTGAATAGAGGGGGAGGTGTGAATCCA[G/A]
TTCCACAATAATCCAACCATTCCATAATGTCCAAGCAATATGAATATTCCCAAAGTCTAGAGTTGTAAAACCACCTAATGTTGCCTAATTAAATAGCGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.10% | 32.80% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 98.10% | 1.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 5.50% | 94.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 90.00% | 9.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 15.10% | 84.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 37.80% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317492428 | C -> T | LOC_Os03g30710.1 | upstream_gene_variant ; 3414.0bp to feature; MODIFIER | silent_mutation | Average:19.945; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0317492428 | C -> T | LOC_Os03g30700.1 | downstream_gene_variant ; 1898.0bp to feature; MODIFIER | silent_mutation | Average:19.945; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0317492428 | C -> T | LOC_Os03g30700-LOC_Os03g30710 | intergenic_region ; MODIFIER | silent_mutation | Average:19.945; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317492428 | NA | 2.81E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317492428 | NA | 5.11E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317492428 | 8.78E-07 | 3.02E-09 | mr1718 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317492428 | NA | 1.43E-09 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317492428 | NA | 9.80E-40 | mr1243_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317492428 | NA | 2.22E-11 | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317492428 | NA | 4.69E-14 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |