| Variant ID: vg0317479328 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17479328 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTATAAACTTTAGGTGTATAAACTTTAGATGTATAGAAATACTACATATAAAATATATTTGAATTCAAATTCAAATTTGAATCGGATATATAAACTTTT[A/G]
ACTTATAAACTTTGGGTCTCTAAACTTTAGATGTGTAAACTTGAGGTGTATAAATTTACTAAAATAGAAAAGTAATGTAGTGCCAAAAAAGGAAACCAGG
CCTGGTTTCCTTTTTTGGCACTACATTACTTTTCTATTTTAGTAAATTTATACACCTCAAGTTTACACATCTAAAGTTTAGAGACCCAAAGTTTATAAGT[T/C]
AAAAGTTTATATATCCGATTCAAATTTGAATTTGAATTCAAATATATTTTATATGTAGTATTTCTATACATCTAAAGTTTATACACCTAAAGTTTATAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.30% | 35.40% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 95.00% | 4.70% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 13.80% | 86.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 24.20% | 74.30% | 1.49% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.70% | 3.80% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 89.90% | 9.40% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 26.20% | 73.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 27.00% | 73.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 33.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317479328 | A -> G | LOC_Os03g30650.1 | upstream_gene_variant ; 4442.0bp to feature; MODIFIER | silent_mutation | Average:24.298; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0317479328 | A -> G | LOC_Os03g30660.1 | upstream_gene_variant ; 1111.0bp to feature; MODIFIER | silent_mutation | Average:24.298; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0317479328 | A -> G | LOC_Os03g30680.1 | upstream_gene_variant ; 3790.0bp to feature; MODIFIER | silent_mutation | Average:24.298; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0317479328 | A -> G | LOC_Os03g30670.1 | downstream_gene_variant ; 2338.0bp to feature; MODIFIER | silent_mutation | Average:24.298; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0317479328 | A -> G | LOC_Os03g30660-LOC_Os03g30670 | intergenic_region ; MODIFIER | silent_mutation | Average:24.298; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317479328 | NA | 1.86E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317479328 | NA | 2.04E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317479328 | NA | 3.58E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317479328 | NA | 7.21E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317479328 | 4.26E-06 | 1.44E-06 | mr1580 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317479328 | 6.45E-06 | NA | mr1702 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317479328 | NA | 1.31E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317479328 | NA | 1.93E-13 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317479328 | 2.49E-06 | 2.49E-06 | mr1159_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317479328 | NA | 2.50E-06 | mr1200_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/