\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317479328:

Variant ID: vg0317479328 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17479328
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTATAAACTTTAGGTGTATAAACTTTAGATGTATAGAAATACTACATATAAAATATATTTGAATTCAAATTCAAATTTGAATCGGATATATAAACTTTT[A/G]
ACTTATAAACTTTGGGTCTCTAAACTTTAGATGTGTAAACTTGAGGTGTATAAATTTACTAAAATAGAAAAGTAATGTAGTGCCAAAAAAGGAAACCAGG

Reverse complement sequence

CCTGGTTTCCTTTTTTGGCACTACATTACTTTTCTATTTTAGTAAATTTATACACCTCAAGTTTACACATCTAAAGTTTAGAGACCCAAAGTTTATAAGT[T/C]
AAAAGTTTATATATCCGATTCAAATTTGAATTTGAATTCAAATATATTTTATATGTAGTATTTCTATACATCTAAAGTTTATACACCTAAAGTTTATAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 35.40% 0.36% 0.00% NA
All Indica  2759 95.00% 4.70% 0.33% 0.00% NA
All Japonica  1512 13.80% 86.20% 0.07% 0.00% NA
Aus  269 24.20% 74.30% 1.49% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 95.70% 3.80% 0.44% 0.00% NA
Indica Intermediate  786 89.90% 9.40% 0.64% 0.00% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 26.20% 73.60% 0.20% 0.00% NA
Japonica Intermediate  241 27.00% 73.00% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 63.30% 33.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317479328 A -> G LOC_Os03g30650.1 upstream_gene_variant ; 4442.0bp to feature; MODIFIER silent_mutation Average:24.298; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0317479328 A -> G LOC_Os03g30660.1 upstream_gene_variant ; 1111.0bp to feature; MODIFIER silent_mutation Average:24.298; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0317479328 A -> G LOC_Os03g30680.1 upstream_gene_variant ; 3790.0bp to feature; MODIFIER silent_mutation Average:24.298; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0317479328 A -> G LOC_Os03g30670.1 downstream_gene_variant ; 2338.0bp to feature; MODIFIER silent_mutation Average:24.298; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0317479328 A -> G LOC_Os03g30660-LOC_Os03g30670 intergenic_region ; MODIFIER silent_mutation Average:24.298; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317479328 NA 1.86E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317479328 NA 2.04E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317479328 NA 3.58E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317479328 NA 7.21E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317479328 4.26E-06 1.44E-06 mr1580 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317479328 6.45E-06 NA mr1702 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317479328 NA 1.31E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317479328 NA 1.93E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317479328 2.49E-06 2.49E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317479328 NA 2.50E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317479328 NA 2.85E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317479328 NA 8.10E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317479328 NA 2.17E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317479328 NA 7.30E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317479328 NA 4.49E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251