Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317475601:

Variant ID: vg0317475601 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17475601
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGTAATTCCGGAAAGTTTCCGACCGATTCCGAGTTCCGATGGAAACTGCCCTTATCATTTCCGATTCCGTTTCCGAGAAAATATTTCCGAATTCGTTTC[T/C]
GTTTCTGAAAAATTCCGACCGACAGATTCCGTTTTCGAAAATAGGTCTGGAATCCGGAAAGATTCCGTACCGTTTTCACCCCTAGTTTGAGGTGATAAGC

Reverse complement sequence

GCTTATCACCTCAAACTAGGGGTGAAAACGGTACGGAATCTTTCCGGATTCCAGACCTATTTTCGAAAACGGAATCTGTCGGTCGGAATTTTTCAGAAAC[A/G]
GAAACGAATTCGGAAATATTTTCTCGGAAACGGAATCGGAAATGATAAGGGCAGTTTCCATCGGAACTCGGAATCGGTCGGAAACTTTCCGGAATTACCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.50% 0.25% 0.00% NA
All Indica  2759 94.30% 5.40% 0.29% 0.00% NA
All Japonica  1512 5.40% 94.60% 0.00% 0.00% NA
Aus  269 14.90% 85.10% 0.00% 0.00% NA
Indica I  595 98.00% 1.70% 0.34% 0.00% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 95.00% 4.80% 0.22% 0.00% NA
Indica Intermediate  786 89.10% 10.60% 0.38% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 15.10% 84.90% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 52.20% 43.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317475601 T -> C LOC_Os03g30640.1 upstream_gene_variant ; 3413.0bp to feature; MODIFIER silent_mutation Average:37.789; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0317475601 T -> C LOC_Os03g30650.1 upstream_gene_variant ; 715.0bp to feature; MODIFIER silent_mutation Average:37.789; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0317475601 T -> C LOC_Os03g30660.1 downstream_gene_variant ; 1900.0bp to feature; MODIFIER silent_mutation Average:37.789; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0317475601 T -> C LOC_Os03g30650-LOC_Os03g30660 intergenic_region ; MODIFIER silent_mutation Average:37.789; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317475601 NA 2.25E-27 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 1.46E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 3.71E-44 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 4.99E-51 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 2.94E-42 mr1129 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 2.32E-17 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 4.34E-12 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 1.88E-31 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 6.26E-29 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 4.60E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 3.85E-19 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 2.34E-32 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 8.50E-12 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 1.38E-10 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 9.06E-42 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 1.28E-29 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 6.88E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 8.29E-32 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 6.24E-09 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 3.69E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 7.10E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 6.57E-13 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 1.04E-53 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 7.52E-57 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 7.53E-62 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 1.92E-41 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 5.28E-42 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 8.84E-27 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 7.78E-25 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 6.76E-38 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 4.67E-25 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 5.71E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 3.06E-42 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 1.40E-40 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 4.68E-13 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475601 NA 4.32E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251