\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317475146:

Variant ID: vg0317475146 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17475146
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGATTTTCTTGGGGTATTTTTATAACGTACTTCTGTATTTTACGGTGCCTAATAATTGGGATTTGTTTGAGGTAGGGGTGAAAACGGTACGGAAACAGA[C/T]
GGAAACCATCTTTATTGTTTTTGTTTTTATTTTATTTTTGGAATCGGAAACCCCAGATACGAAAACGGAATCGAATATTATCGAAACCGAAAACGGAGCG

Reverse complement sequence

CGCTCCGTTTTCGGTTTCGATAATATTCGATTCCGTTTTCGTATCTGGGGTTTCCGATTCCAAAAATAAAATAAAAACAAAAACAATAAAGATGGTTTCC[G/A]
TCTGTTTCCGTACCGTTTTCACCCCTACCTCAAACAAATCCCAATTATTAGGCACCGTAAAATACAGAAGTACGTTATAAAAATACCCCAAGAAAATCCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.40% 0.19% 0.08% NA
All Indica  2759 94.60% 5.10% 0.18% 0.07% NA
All Japonica  1512 5.40% 94.50% 0.00% 0.13% NA
Aus  269 13.00% 87.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.50% 0.17% 0.17% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 95.60% 4.30% 0.11% 0.00% NA
Indica Intermediate  786 88.80% 10.70% 0.38% 0.13% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 15.10% 84.70% 0.00% 0.20% NA
Japonica Intermediate  241 1.70% 97.90% 0.00% 0.41% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 53.30% 42.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317475146 C -> T LOC_Os03g30640.1 upstream_gene_variant ; 2958.0bp to feature; MODIFIER silent_mutation Average:52.895; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N
vg0317475146 C -> T LOC_Os03g30650.1 upstream_gene_variant ; 260.0bp to feature; MODIFIER silent_mutation Average:52.895; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N
vg0317475146 C -> T LOC_Os03g30660.1 downstream_gene_variant ; 2355.0bp to feature; MODIFIER silent_mutation Average:52.895; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N
vg0317475146 C -> T LOC_Os03g30650-LOC_Os03g30660 intergenic_region ; MODIFIER silent_mutation Average:52.895; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N
vg0317475146 C -> DEL N N silent_mutation Average:52.895; most accessible tissue: Zhenshan97 root, score: 69.506 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317475146 NA 2.63E-28 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 1.12E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 3.96E-44 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 3.24E-52 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 8.07E-40 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 7.32E-16 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 1.63E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 2.91E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 1.27E-27 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 3.42E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 1.96E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 2.33E-31 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 9.03E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 8.05E-10 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 2.16E-40 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 1.28E-28 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 5.04E-33 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 2.59E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 6.11E-31 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 1.17E-54 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 1.75E-56 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 8.33E-67 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 2.08E-41 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 2.62E-42 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 4.44E-27 mr1253_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 1.05E-23 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 1.32E-37 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 1.35E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 2.00E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 1.51E-42 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 2.14E-06 NA mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317475146 NA 9.37E-42 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251