Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317414701:

Variant ID: vg0317414701 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17414701
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCACGCATGCTTGCCAGCTCCTACGTTCTACAGAGTACGTTTTGTATTCTTTATATGTCCCCCATATATATTGGTACAGGAGTACATACTACGACTATA[A/G]
TCTTATACCATAAGTACATGAGAGAGAGAACAATATGGATTCTCTCTGTCTCAGAATATATAGCAATCTAAAACCGAATGTGCTTTATGATAATACAATG

Reverse complement sequence

CATTGTATTATCATAAAGCACATTCGGTTTTAGATTGCTATATATTCTGAGACAGAGAGAATCCATATTGTTCTCTCTCTCATGTACTTATGGTATAAGA[T/C]
TATAGTCGTAGTATGTACTCCTGTACCAATATATATGGGGGACATATAAAGAATACAAAACGTACTCTGTAGAACGTAGGAGCTGGCAAGCATGCGTGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.60% 29.30% 0.04% 0.02% NA
All Indica  2759 98.40% 1.60% 0.00% 0.00% NA
All Japonica  1512 13.00% 86.90% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 23.40% 76.60% 0.00% 0.00% NA
Japonica Intermediate  241 26.10% 73.00% 0.83% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317414701 A -> DEL N N silent_mutation Average:91.427; most accessible tissue: Callus, score: 99.131 N N N N
vg0317414701 A -> G LOC_Os03g30519.1 upstream_gene_variant ; 1747.0bp to feature; MODIFIER silent_mutation Average:91.427; most accessible tissue: Callus, score: 99.131 N N N N
vg0317414701 A -> G LOC_Os03g30519.2 upstream_gene_variant ; 1747.0bp to feature; MODIFIER silent_mutation Average:91.427; most accessible tissue: Callus, score: 99.131 N N N N
vg0317414701 A -> G LOC_Os03g30519-LOC_Os03g30530 intergenic_region ; MODIFIER silent_mutation Average:91.427; most accessible tissue: Callus, score: 99.131 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0317414701 A G -0.03 0.0 -0.03 0.08 0.04 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317414701 2.68E-06 NA mr1023 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317414701 NA 1.12E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317414701 NA 8.52E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317414701 NA 6.20E-33 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317414701 4.17E-07 NA mr1142 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317414701 NA 1.13E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317414701 NA 1.34E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317414701 NA 3.51E-09 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317414701 1.95E-06 NA mr1489 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317414701 6.14E-06 NA mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317414701 NA 1.80E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317414701 NA 1.03E-07 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317414701 NA 1.13E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251