\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317365562:

Variant ID: vg0317365562 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17365562
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.33, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


CCCTCAGGCGTTTGATCATTGTGTTCTATCGGTGCAAAGTGCTTATGGGGTATGACAGTTTCTTGACTAGAAGTGCTAGGTGTATTTTTCATGGCAAATT[C/T]
ATTGTCAAAGAATGTAGCATCTCTGGACTCAATAATTGTACCAACACGCATGTCGGGTACTCCATAGTTTACTATTAAGAATCTATAACCCACACTGTGA

Reverse complement sequence

TCACAGTGTGGGTTATAGATTCTTAATAGTAAACTATGGAGTACCCGACATGCGTGTTGGTACAATTATTGAGTCCAGAGATGCTACATTCTTTGACAAT[G/A]
AATTTGCCATGAAAAATACACCTAGCACTTCTAGTCAAGAAACTGTCATACCCCATAAGCACTTTGCACCGATAGAACACAATGATCAAACGCCTGAGGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.80% 34.20% 0.11% 1.90% NA
All Indica  2759 94.70% 5.10% 0.00% 0.18% NA
All Japonica  1512 4.90% 94.40% 0.07% 0.66% NA
Aus  269 97.80% 1.90% 0.00% 0.37% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 90.30% 9.70% 0.00% 0.00% NA
Indica III  913 93.90% 5.70% 0.00% 0.44% NA
Indica Intermediate  786 95.40% 4.50% 0.00% 0.13% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 13.70% 84.70% 0.00% 1.59% NA
Japonica Intermediate  241 0.80% 97.90% 0.41% 0.83% NA
VI/Aromatic  96 17.70% 11.50% 2.08% 68.75% NA
Intermediate  90 51.10% 37.80% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317365562 C -> T LOC_Os03g30450.1 missense_variant ; p.Glu1089Lys; MODERATE nonsynonymous_codon ; E1089K Average:36.618; most accessible tissue: Minghui63 flower, score: 58.727 benign 1.439 DELETERIOUS 0.04
vg0317365562 C -> DEL LOC_Os03g30450.1 N frameshift_variant Average:36.618; most accessible tissue: Minghui63 flower, score: 58.727 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317365562 3.46E-07 1.62E-13 mr1016 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 8.18E-13 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 3.39E-13 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 5.87E-06 2.00E-12 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 1.47E-06 4.82E-13 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 3.57E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 4.11E-06 4.15E-12 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 8.56E-13 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 8.51E-13 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 1.83E-07 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 4.94E-12 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 2.40E-12 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 5.79E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 8.78E-115 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 3.94E-07 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 1.60E-13 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 1.39E-12 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 2.35E-12 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 3.51E-40 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 1.16E-12 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 4.24E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 4.24E-17 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 3.14E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 1.51E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 5.25E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 8.53E-09 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 1.07E-107 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 7.68E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562 NA 1.73E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251