RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0317365562:

Variant ID: vg0317365562 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17365562
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.33, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

CCCTCAGGCGTTTGATCATTGTGTTCTATCGGTGCAAAGTGCTTATGGGGTATGACAGTTTCTTGACTAGAAGTGCTAGGTGTATTTTTCATGGCAAATT[C/T]
ATTGTCAAAGAATGTAGCATCTCTGGACTCAATAATTGTACCAACACGCATGTCGGGTACTCCATAGTTTACTATTAAGAATCTATAACCCACACTGTGA

Reverse complement sequence

TCACAGTGTGGGTTATAGATTCTTAATAGTAAACTATGGAGTACCCGACATGCGTGTTGGTACAATTATTGAGTCCAGAGATGCTACATTCTTTGACAAT[G/A]
AATTTGCCATGAAAAATACACCTAGCACTTCTAGTCAAGAAACTGTCATACCCCATAAGCACTTTGCACCGATAGAACACAATGATCAAACGCCTGAGGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.80%	34.20%	0.11%	1.90%	NA
All Indica	2759	94.70%	5.10%	0.00%	0.18%	NA
All Japonica	1512	4.90%	94.40%	0.07%	0.66%	NA
Aus	269	97.80%	1.90%	0.00%	0.37%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	90.30%	9.70%	0.00%	0.00%	NA
Indica III	913	93.90%	5.70%	0.00%	0.44%	NA
Indica Intermediate	786	95.40%	4.50%	0.00%	0.13%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	13.70%	84.70%	0.00%	1.59%	NA
Japonica Intermediate	241	0.80%	97.90%	0.41%	0.83%	NA
VI/Aromatic	96	17.70%	11.50%	2.08%	68.75%	NA
Intermediate	90	51.10%	37.80%	2.22%	8.89%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317365562	C -> T	LOC_Os03g30450.1	missense_variant ; p.Glu1089Lys; MODERATE	nonsynonymous_codon ; E1089K	Average:36.618; most accessible tissue: Minghui63 flower, score: 58.727	benign	1.439	DELETERIOUS	0.04
vg0317365562	C -> DEL	LOC_Os03g30450.1	N	frameshift_variant	Average:36.618; most accessible tissue: Minghui63 flower, score: 58.727	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317365562	3.46E-07	1.62E-13	mr1016	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562	NA	8.18E-13	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562	NA	3.39E-13	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562	5.87E-06	2.00E-12	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562	1.47E-06	4.82E-13	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562	NA	3.57E-12	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562	4.11E-06	4.15E-12	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562	NA	8.56E-13	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562	NA	8.51E-13	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317365562	NA	1.83E-07	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 29 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0317365562:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact