\
| Variant ID: vg0317363099 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17363099 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 94. )
TTACGGAGGCAATCTCGGGATTGGTCCGTTGCAAAAGACGCCACGCCCATGCCCACGGCCTCGGCCCGGCCTGGCCGGTCGGCTCGGCTCCGCGCGCGCG[T/C]
GCGTGTGGCTTTCTGATCCCCACCTCAACCGGTCAACAGGGAGCCTCCAATAACTCCCTATTTAAGTTGAGATACTCCTCGTTTAATTCCCAAGGTGGTA
TACCACCTTGGGAATTAAACGAGGAGTATCTCAACTTAAATAGGGAGTTATTGGAGGCTCCCTGTTGACCGGTTGAGGTGGGGATCAGAAAGCCACACGC[A/G]
CGCGCGCGCGGAGCCGAGCCGACCGGCCAGGCCGGGCCGAGGCCGTGGGCATGGGCGTGGCGTCTTTTGCAACGGACCAATCCCGAGATTGCCTCCGTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.30% | 35.50% | 1.31% | 1.84% | NA |
| All Indica | 2759 | 90.90% | 7.20% | 1.70% | 0.18% | NA |
| All Japonica | 1512 | 5.00% | 94.30% | 0.40% | 0.26% | NA |
| Aus | 269 | 96.70% | 2.20% | 0.74% | 0.37% | NA |
| Indica I | 595 | 97.10% | 2.00% | 0.84% | 0.00% | NA |
| Indica II | 465 | 85.80% | 11.80% | 2.37% | 0.00% | NA |
| Indica III | 913 | 90.00% | 8.20% | 1.31% | 0.44% | NA |
| Indica Intermediate | 786 | 90.20% | 7.30% | 2.42% | 0.13% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 14.10% | 84.50% | 1.19% | 0.20% | NA |
| Japonica Intermediate | 241 | 0.80% | 97.90% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 12.50% | 12.50% | 3.12% | 71.88% | NA |
| Intermediate | 90 | 47.80% | 38.90% | 4.44% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317363099 | T -> C | LOC_Os03g30440.1 | upstream_gene_variant ; 3811.0bp to feature; MODIFIER | silent_mutation | Average:56.496; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| vg0317363099 | T -> C | LOC_Os03g30450.1 | downstream_gene_variant ; 1096.0bp to feature; MODIFIER | silent_mutation | Average:56.496; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| vg0317363099 | T -> C | LOC_Os03g30440-LOC_Os03g30450 | intergenic_region ; MODIFIER | silent_mutation | Average:56.496; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| vg0317363099 | T -> DEL | N | N | silent_mutation | Average:56.496; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317363099 | NA | 6.75E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | 1.48E-06 | NA | mr1115_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | 6.52E-06 | 1.24E-40 | mr1243_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 2.80E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 1.08E-23 | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 1.39E-16 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 1.58E-11 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 3.41E-36 | mr1541_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 2.94E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 6.92E-22 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | 7.84E-06 | NA | mr1611_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 1.90E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 7.55E-08 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 2.70E-13 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 5.43E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 4.87E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 3.06E-15 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 1.86E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 7.22E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 1.55E-08 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 7.20E-20 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317363099 | NA | 4.39E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |