\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317363099:

Variant ID: vg0317363099 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17363099
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTACGGAGGCAATCTCGGGATTGGTCCGTTGCAAAAGACGCCACGCCCATGCCCACGGCCTCGGCCCGGCCTGGCCGGTCGGCTCGGCTCCGCGCGCGCG[T/C]
GCGTGTGGCTTTCTGATCCCCACCTCAACCGGTCAACAGGGAGCCTCCAATAACTCCCTATTTAAGTTGAGATACTCCTCGTTTAATTCCCAAGGTGGTA

Reverse complement sequence

TACCACCTTGGGAATTAAACGAGGAGTATCTCAACTTAAATAGGGAGTTATTGGAGGCTCCCTGTTGACCGGTTGAGGTGGGGATCAGAAAGCCACACGC[A/G]
CGCGCGCGCGGAGCCGAGCCGACCGGCCAGGCCGGGCCGAGGCCGTGGGCATGGGCGTGGCGTCTTTTGCAACGGACCAATCCCGAGATTGCCTCCGTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 35.50% 1.31% 1.84% NA
All Indica  2759 90.90% 7.20% 1.70% 0.18% NA
All Japonica  1512 5.00% 94.30% 0.40% 0.26% NA
Aus  269 96.70% 2.20% 0.74% 0.37% NA
Indica I  595 97.10% 2.00% 0.84% 0.00% NA
Indica II  465 85.80% 11.80% 2.37% 0.00% NA
Indica III  913 90.00% 8.20% 1.31% 0.44% NA
Indica Intermediate  786 90.20% 7.30% 2.42% 0.13% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 14.10% 84.50% 1.19% 0.20% NA
Japonica Intermediate  241 0.80% 97.90% 0.00% 1.24% NA
VI/Aromatic  96 12.50% 12.50% 3.12% 71.88% NA
Intermediate  90 47.80% 38.90% 4.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317363099 T -> C LOC_Os03g30440.1 upstream_gene_variant ; 3811.0bp to feature; MODIFIER silent_mutation Average:56.496; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0317363099 T -> C LOC_Os03g30450.1 downstream_gene_variant ; 1096.0bp to feature; MODIFIER silent_mutation Average:56.496; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0317363099 T -> C LOC_Os03g30440-LOC_Os03g30450 intergenic_region ; MODIFIER silent_mutation Average:56.496; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0317363099 T -> DEL N N silent_mutation Average:56.496; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317363099 NA 6.75E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 1.48E-06 NA mr1115_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 6.52E-06 1.24E-40 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 2.80E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 1.08E-23 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 1.39E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 1.58E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 3.41E-36 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 2.94E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 6.92E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 7.84E-06 NA mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 1.90E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 7.55E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 2.70E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 5.43E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 4.87E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 3.06E-15 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 1.86E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 7.22E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 1.55E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 7.20E-20 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317363099 NA 4.39E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251