Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317279395:

Variant ID: vg0317279395 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17279395
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


CACTATTTCCCCCACTCACTCCGCAAGAAACGGCGCCGGTTTGACCTCCCCACGAGCTCCACTTCGCCTCCTCACGTCGCCGGCCGATCCCGTCTCTCCC[A/G]
GCCACGATCTCCATCCCCGAGCCCTATATAAAGCACCCTCGTGCTCTCGTCTTCCGTTTCCCCCTCCTCCCCGAGCTCCTCGCACCCTCTCCCGTGCTCC

Reverse complement sequence

GGAGCACGGGAGAGGGTGCGAGGAGCTCGGGGAGGAGGGGGAAACGGAAGACGAGAGCACGAGGGTGCTTTATATAGGGCTCGGGGATGGAGATCGTGGC[T/C]
GGGAGAGACGGGATCGGCCGGCGACGTGAGGAGGCGAAGTGGAGCTCGTGGGGAGGTCAAACCGGCGCCGTTTCTTGCGGAGTGAGTGGGGGAAATAGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 35.40% 0.13% 1.93% NA
All Indica  2759 94.30% 5.30% 0.18% 0.18% NA
All Japonica  1512 3.20% 96.20% 0.00% 0.66% NA
Aus  269 90.70% 8.90% 0.00% 0.37% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 90.10% 9.70% 0.22% 0.00% NA
Indica III  913 93.80% 5.70% 0.11% 0.44% NA
Indica Intermediate  786 94.50% 5.10% 0.25% 0.13% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 8.70% 89.70% 0.00% 1.59% NA
Japonica Intermediate  241 0.40% 98.80% 0.00% 0.83% NA
VI/Aromatic  96 16.70% 13.50% 0.00% 69.79% NA
Intermediate  90 48.90% 41.10% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317279395 A -> DEL N N silent_mutation Average:84.978; most accessible tissue: Minghui63 flag leaf, score: 94.221 N N N N
vg0317279395 A -> G LOC_Os03g30280.1 upstream_gene_variant ; 174.0bp to feature; MODIFIER silent_mutation Average:84.978; most accessible tissue: Minghui63 flag leaf, score: 94.221 N N N N
vg0317279395 A -> G LOC_Os03g30270.1 downstream_gene_variant ; 1343.0bp to feature; MODIFIER silent_mutation Average:84.978; most accessible tissue: Minghui63 flag leaf, score: 94.221 N N N N
vg0317279395 A -> G LOC_Os03g30280-LOC_Os03g30290 intergenic_region ; MODIFIER silent_mutation Average:84.978; most accessible tissue: Minghui63 flag leaf, score: 94.221 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0317279395 A G 0.01 0.02 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317279395 NA 4.61E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 6.60E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 1.02E-40 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 9.60E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 1.01E-40 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 1.98E-20 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 9.18E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 2.45E-25 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 2.69E-06 6.76E-20 mr1416_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 1.78E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 1.00E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 4.10E-06 mr1578_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 9.76E-58 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 4.46E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 8.34E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 1.04E-32 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 1.97E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 6.17E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 1.13E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317279395 NA 2.95E-20 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251