\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317273290:

Variant ID: vg0317273290 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 17273290
Reference Allele: TAlternative Allele: C,TATTTTTTACCATTTCC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.56, T: 0.44, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


AAACGGAGGGAGTATATTATAAGAAAGGGTAATTTCCACAAAAATACGGTAAATAAGGAAATGATCGGTATAATAGCAAAACCATTTCCGTTTCCATTTC[T/C,TATTTTTTACCATTTCC]
ATTTTCGATTCGATCGATTACCATTTCCATATGGCTTGGCTGGTAGAAAGTCGGAAACGAACATCGGTTGGCCGGGAATTTCCATTACCGTTTTCAGCCC

Reverse complement sequence

GGGCTGAAAACGGTAATGGAAATTCCCGGCCAACCGATGTTCGTTTCCGACTTTCTACCAGCCAAGCCATATGGAAATGGTAATCGATCGAATCGAAAAT[A/G,GGAAATGGTAAAAAATA]
GAAATGGAAACGGAAATGGTTTTGCTATTATACCGATCATTTCCTTATTTACCGTATTTTTGTGGAAATTACCCTTTCTTATAATATACTCCCTCCGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 35.70% 0.91% 0.00% TATTTTTTACCATTTCC: 0.83%
All Indica  2759 93.90% 5.60% 0.36% 0.00% TATTTTTTACCATTTCC: 0.07%
All Japonica  1512 3.20% 96.20% 0.33% 0.00% TATTTTTTACCATTTCC: 0.33%
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 97.30% 2.50% 0.17% 0.00% NA
Indica II  465 90.10% 9.90% 0.00% 0.00% NA
Indica III  913 93.50% 5.80% 0.44% 0.00% TATTTTTTACCATTTCC: 0.22%
Indica Intermediate  786 94.10% 5.20% 0.64% 0.00% NA
Temperate Japonica  767 0.30% 99.60% 0.13% 0.00% NA
Tropical Japonica  504 8.90% 89.70% 0.79% 0.00% TATTTTTTACCATTTCC: 0.60%
Japonica Intermediate  241 0.40% 98.80% 0.00% 0.00% TATTTTTTACCATTTCC: 0.83%
VI/Aromatic  96 29.20% 14.60% 26.04% 0.00% TATTTTTTACCATTTCC: 30.21%
Intermediate  90 50.00% 43.30% 3.33% 0.00% TATTTTTTACCATTTCC: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317273290 T -> C LOC_Os03g30264.1 upstream_gene_variant ; 1298.0bp to feature; MODIFIER silent_mutation Average:30.182; most accessible tissue: Callus, score: 49.982 N N N N
vg0317273290 T -> C LOC_Os03g30270.1 upstream_gene_variant ; 2695.0bp to feature; MODIFIER silent_mutation Average:30.182; most accessible tissue: Callus, score: 49.982 N N N N
vg0317273290 T -> C LOC_Os03g30264-LOC_Os03g30270 intergenic_region ; MODIFIER silent_mutation Average:30.182; most accessible tissue: Callus, score: 49.982 N N N N
vg0317273290 T -> TATTTTTTACCATTTCC LOC_Os03g30264.1 upstream_gene_variant ; 1299.0bp to feature; MODIFIER silent_mutation Average:30.182; most accessible tissue: Callus, score: 49.982 N N N N
vg0317273290 T -> TATTTTTTACCATTTCC LOC_Os03g30270.1 upstream_gene_variant ; 2694.0bp to feature; MODIFIER silent_mutation Average:30.182; most accessible tissue: Callus, score: 49.982 N N N N
vg0317273290 T -> TATTTTTTACCATTTCC LOC_Os03g30264-LOC_Os03g30270 intergenic_region ; MODIFIER silent_mutation Average:30.182; most accessible tissue: Callus, score: 49.982 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317273290 NA 1.02E-10 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 7.17E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 6.78E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 2.44E-10 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 3.88E-37 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 3.76E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 8.47E-07 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 5.93E-13 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 8.56E-10 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 8.24E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 1.80E-15 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 2.90E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 8.96E-13 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 3.86E-06 2.83E-08 mr1063_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 7.73E-13 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 3.11E-06 mr1177_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 1.50E-06 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 8.95E-07 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 3.96E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 6.54E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 7.60E-06 1.78E-08 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 8.83E-07 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 1.37E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 9.98E-26 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 1.50E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 9.53E-09 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 3.44E-12 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 6.55E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 1.49E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 2.13E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 1.74E-06 mr1638_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 1.10E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 4.01E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 4.23E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 1.42E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 3.16E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 6.44E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 5.30E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 9.79E-08 mr1740_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 1.84E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 2.04E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 1.77E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 5.54E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 1.83E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 1.62E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 6.85E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317273290 NA 3.59E-06 mr1976_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251