\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317255027:

Variant ID: vg0317255027 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17255027
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAAAATAATTCAATAATAAGCTAAAATGTTTTTCGTCGGAATATATTCATGTGTGGTCTTGTTTTAAAGATTTAATTGCAACAAATTTAATGGTGCAAT[T/C]
GGATCATGATTTGGATAAATAATTTAAGGGCATCTTCGGATTACAGTATTTTCAAAGGATTTTTGAAGGAATAATGTTGACATGGATTTTTTCCTTTCCT

Reverse complement sequence

AGGAAAGGAAAAAATCCATGTCAACATTATTCCTTCAAAAATCCTTTGAAAATACTGTAATCCGAAGATGCCCTTAAATTATTTATCCAAATCATGATCC[A/G]
ATTGCACCATTAAATTTGTTGCAATTAAATCTTTAAAACAAGACCACACATGAATATATTCCGACGAAAAACATTTTAGCTTATTATTGAATTATTTTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.40% 2.10% 1.06% 59.42% NA
All Indica  2759 8.40% 0.40% 1.63% 89.56% NA
All Japonica  1512 96.30% 0.10% 0.20% 3.37% NA
Aus  269 10.80% 0.70% 0.37% 88.10% NA
Indica I  595 9.40% 0.00% 1.01% 89.58% NA
Indica II  465 11.80% 0.00% 1.29% 86.88% NA
Indica III  913 6.20% 0.50% 2.63% 90.58% NA
Indica Intermediate  786 8.30% 0.60% 1.15% 89.95% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 89.90% 0.00% 0.60% 9.52% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 11.50% 77.10% 0.00% 11.46% NA
Intermediate  90 43.30% 13.30% 1.11% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317255027 T -> C LOC_Os03g30230.1 downstream_gene_variant ; 926.0bp to feature; MODIFIER silent_mutation Average:21.514; most accessible tissue: Minghui63 flower, score: 33.997 N N N N
vg0317255027 T -> C LOC_Os03g30240.1 downstream_gene_variant ; 3634.0bp to feature; MODIFIER silent_mutation Average:21.514; most accessible tissue: Minghui63 flower, score: 33.997 N N N N
vg0317255027 T -> C LOC_Os03g30230-LOC_Os03g30240 intergenic_region ; MODIFIER silent_mutation Average:21.514; most accessible tissue: Minghui63 flower, score: 33.997 N N N N
vg0317255027 T -> DEL N N silent_mutation Average:21.514; most accessible tissue: Minghui63 flower, score: 33.997 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317255027 4.35E-06 NA mr1333 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317255027 2.42E-06 NA mr1682 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251