Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0317255027:

Variant ID: vg0317255027 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17255027
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAAAATAATTCAATAATAAGCTAAAATGTTTTTCGTCGGAATATATTCATGTGTGGTCTTGTTTTAAAGATTTAATTGCAACAAATTTAATGGTGCAAT[T/C]
GGATCATGATTTGGATAAATAATTTAAGGGCATCTTCGGATTACAGTATTTTCAAAGGATTTTTGAAGGAATAATGTTGACATGGATTTTTTCCTTTCCT

Reverse complement sequence

AGGAAAGGAAAAAATCCATGTCAACATTATTCCTTCAAAAATCCTTTGAAAATACTGTAATCCGAAGATGCCCTTAAATTATTTATCCAAATCATGATCC[A/G]
ATTGCACCATTAAATTTGTTGCAATTAAATCTTTAAAACAAGACCACACATGAATATATTCCGACGAAAAACATTTTAGCTTATTATTGAATTATTTTTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.40%	2.10%	1.06%	59.42%	NA
All Indica	2759	8.40%	0.40%	1.63%	89.56%	NA
All Japonica	1512	96.30%	0.10%	0.20%	3.37%	NA
Aus	269	10.80%	0.70%	0.37%	88.10%	NA
Indica I	595	9.40%	0.00%	1.01%	89.58%	NA
Indica II	465	11.80%	0.00%	1.29%	86.88%	NA
Indica III	913	6.20%	0.50%	2.63%	90.58%	NA
Indica Intermediate	786	8.30%	0.60%	1.15%	89.95%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	89.90%	0.00%	0.60%	9.52%	NA
Japonica Intermediate	241	98.80%	0.80%	0.00%	0.41%	NA
VI/Aromatic	96	11.50%	77.10%	0.00%	11.46%	NA
Intermediate	90	43.30%	13.30%	1.11%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317255027	T -> C	LOC_Os03g30230.1	downstream_gene_variant ; 926.0bp to feature; MODIFIER	silent_mutation	Average:21.514; most accessible tissue: Minghui63 flower, score: 33.997	N	N	N	N
vg0317255027	T -> C	LOC_Os03g30240.1	downstream_gene_variant ; 3634.0bp to feature; MODIFIER	silent_mutation	Average:21.514; most accessible tissue: Minghui63 flower, score: 33.997	N	N	N	N
vg0317255027	T -> C	LOC_Os03g30230-LOC_Os03g30240	intergenic_region ; MODIFIER	silent_mutation	Average:21.514; most accessible tissue: Minghui63 flower, score: 33.997	N	N	N	N
vg0317255027	T -> DEL	N	N	silent_mutation	Average:21.514; most accessible tissue: Minghui63 flower, score: 33.997	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317255027	4.35E-06	NA	mr1333	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317255027	2.42E-06	NA	mr1682	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251