Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0317244657:

Variant ID: vg0317244657 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17244657
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, C: 0.18, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTGAAACCAAATGCATTAGTCTTAGAAAACACACCTCTACACCCCTGTGAAGTCTAATATAATAAAAATCACTTTACAAAAGTATTTTATAACACTAC[A/C]
TAAGACTATACTACTATAAACCGATAAAACTTCTAAAATTCATAACTCCCTAATGGAATAAGATAAAATAGTAATTCTTTCACCTAAATTCATTTTAGAT

Reverse complement sequence

ATCTAAAATGAATTTAGGTGAAAGAATTACTATTTTATCTTATTCCATTAGGGAGTTATGAATTTTAGAAGTTTTATCGGTTTATAGTAGTATAGTCTTA[T/G]
GTAGTGTTATAAAATACTTTTGTAAAGTGATTTTTATTATATTAGACTTCACAGGGGTGTAGAGGTGTGTTTTCTAAGACTAATGCATTTGGTTTCACAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.10%	0.80%	7.98%	52.16%	NA
All Indica	2759	8.00%	1.30%	5.69%	84.96%	NA
All Japonica	1512	96.20%	0.00%	0.13%	3.64%	NA
Aus	269	11.20%	0.40%	76.95%	11.52%	NA
Indica I	595	7.10%	0.00%	1.68%	91.26%	NA
Indica II	465	11.60%	0.00%	2.80%	85.59%	NA
Indica III	913	7.00%	3.40%	9.42%	80.18%	NA
Indica Intermediate	786	7.80%	0.80%	6.11%	85.37%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	89.10%	0.00%	0.40%	10.52%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	88.50%	0.00%	7.29%	4.17%	NA
Intermediate	90	61.10%	0.00%	4.44%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317244657	A -> C	LOC_Os03g30220.1	upstream_gene_variant ; 3660.0bp to feature; MODIFIER	silent_mutation	Average:27.465; most accessible tissue: Minghui63 flower, score: 55.046	N	N	N	N
vg0317244657	A -> C	LOC_Os03g30200.1	downstream_gene_variant ; 3576.0bp to feature; MODIFIER	silent_mutation	Average:27.465; most accessible tissue: Minghui63 flower, score: 55.046	N	N	N	N
vg0317244657	A -> C	LOC_Os03g30200.2	downstream_gene_variant ; 3576.0bp to feature; MODIFIER	silent_mutation	Average:27.465; most accessible tissue: Minghui63 flower, score: 55.046	N	N	N	N
vg0317244657	A -> C	LOC_Os03g30200-LOC_Os03g30220	intergenic_region ; MODIFIER	silent_mutation	Average:27.465; most accessible tissue: Minghui63 flower, score: 55.046	N	N	N	N
vg0317244657	A -> DEL	N	N	silent_mutation	Average:27.465; most accessible tissue: Minghui63 flower, score: 55.046	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317244657	6.82E-06	NA	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317244657	1.71E-06	NA	mr1161	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251