\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317244657:

Variant ID: vg0317244657 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17244657
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, C: 0.18, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTGAAACCAAATGCATTAGTCTTAGAAAACACACCTCTACACCCCTGTGAAGTCTAATATAATAAAAATCACTTTACAAAAGTATTTTATAACACTAC[A/C]
TAAGACTATACTACTATAAACCGATAAAACTTCTAAAATTCATAACTCCCTAATGGAATAAGATAAAATAGTAATTCTTTCACCTAAATTCATTTTAGAT

Reverse complement sequence

ATCTAAAATGAATTTAGGTGAAAGAATTACTATTTTATCTTATTCCATTAGGGAGTTATGAATTTTAGAAGTTTTATCGGTTTATAGTAGTATAGTCTTA[T/G]
GTAGTGTTATAAAATACTTTTGTAAAGTGATTTTTATTATATTAGACTTCACAGGGGTGTAGAGGTGTGTTTTCTAAGACTAATGCATTTGGTTTCACAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.10% 0.80% 7.98% 52.16% NA
All Indica  2759 8.00% 1.30% 5.69% 84.96% NA
All Japonica  1512 96.20% 0.00% 0.13% 3.64% NA
Aus  269 11.20% 0.40% 76.95% 11.52% NA
Indica I  595 7.10% 0.00% 1.68% 91.26% NA
Indica II  465 11.60% 0.00% 2.80% 85.59% NA
Indica III  913 7.00% 3.40% 9.42% 80.18% NA
Indica Intermediate  786 7.80% 0.80% 6.11% 85.37% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 89.10% 0.00% 0.40% 10.52% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 88.50% 0.00% 7.29% 4.17% NA
Intermediate  90 61.10% 0.00% 4.44% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317244657 A -> C LOC_Os03g30220.1 upstream_gene_variant ; 3660.0bp to feature; MODIFIER silent_mutation Average:27.465; most accessible tissue: Minghui63 flower, score: 55.046 N N N N
vg0317244657 A -> C LOC_Os03g30200.1 downstream_gene_variant ; 3576.0bp to feature; MODIFIER silent_mutation Average:27.465; most accessible tissue: Minghui63 flower, score: 55.046 N N N N
vg0317244657 A -> C LOC_Os03g30200.2 downstream_gene_variant ; 3576.0bp to feature; MODIFIER silent_mutation Average:27.465; most accessible tissue: Minghui63 flower, score: 55.046 N N N N
vg0317244657 A -> C LOC_Os03g30200-LOC_Os03g30220 intergenic_region ; MODIFIER silent_mutation Average:27.465; most accessible tissue: Minghui63 flower, score: 55.046 N N N N
vg0317244657 A -> DEL N N silent_mutation Average:27.465; most accessible tissue: Minghui63 flower, score: 55.046 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317244657 6.82E-06 NA mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317244657 1.71E-06 NA mr1161 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251