\
| Variant ID: vg0317228312 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17228312 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGGATTCAAGTAATGCAAGCTAATCCCGTAGAAGTTCAGAATTCCCCGGAAGAATCTTGAGGTTGGAAGGGAGAAACCACCATAGAAGAAATGAGCAAA[C/T]
ACCACGATCTCGTGTGTATCGGGGGTCGGGAATGCTTCACCAAATGCCGGTCACCACCCGATGATTTCCTTCGCCGGAAGAACGCCGTGCGCCACCATCT
AGATGGTGGCGCACGGCGTTCTTCCGGCGAAGGAAATCATCGGGTGGTGACCGGCATTTGGTGAAGCATTCCCGACCCCCGATACACACGAGATCGTGGT[G/A]
TTTGCTCATTTCTTCTATGGTGGTTTCTCCCTTCCAACCTCAAGATTCTTCCGGGGAATTCTGAACTTCTACGGGATTAGCTTGCATTACTTGAATCCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.90% | 2.10% | 0.78% | 59.23% | NA |
| All Indica | 2759 | 9.10% | 0.30% | 1.16% | 89.42% | NA |
| All Japonica | 1512 | 96.10% | 0.10% | 0.26% | 3.51% | NA |
| Aus | 269 | 11.90% | 1.10% | 0.37% | 86.62% | NA |
| Indica I | 595 | 9.40% | 0.00% | 1.18% | 89.41% | NA |
| Indica II | 465 | 12.90% | 0.00% | 1.51% | 85.59% | NA |
| Indica III | 913 | 6.70% | 0.50% | 0.99% | 91.79% | NA |
| Indica Intermediate | 786 | 9.40% | 0.50% | 1.15% | 88.93% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 89.50% | 0.00% | 0.60% | 9.92% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 12.50% | 77.10% | 0.00% | 10.42% | NA |
| Intermediate | 90 | 45.60% | 14.40% | 0.00% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317228312 | C -> T | LOC_Os03g30180.1 | downstream_gene_variant ; 3445.0bp to feature; MODIFIER | silent_mutation | Average:31.877; most accessible tissue: Minghui63 flower, score: 61.151 | N | N | N | N |
| vg0317228312 | C -> T | LOC_Os03g30190.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.877; most accessible tissue: Minghui63 flower, score: 61.151 | N | N | N | N |
| vg0317228312 | C -> DEL | N | N | silent_mutation | Average:31.877; most accessible tissue: Minghui63 flower, score: 61.151 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317228312 | NA | 8.67E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317228312 | 9.86E-07 | NA | mr1538 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317228312 | 1.49E-06 | 9.78E-07 | mr1538 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |