Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317222323:

Variant ID: vg0317222323 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17222323
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GACAGGAAGGATGCGATCAAGGAGGAATTAACCAAGCTGTTAGCGGCGGGCTTCATTAAAGAAGTCCTTCATCCCGACTGGCTGGCTAACCCAGTCCTGG[T/A]
TCGGAAAAAGACGGGGCAATAGTGCATGTGTGTTGATTATACCGACCTCAACAAGTCTTGTCCCAAAGATCCTTTTGGGTTACCTCGCATTGACCAGGTA

Reverse complement sequence

TACCTGGTCAATGCGAGGTAACCCAAAAGGATCTTTGGGACAAGACTTGTTGAGGTCGGTATAATCAACACACATGCACTATTGCCCCGTCTTTTTCCGA[A/T]
CCAGGACTGGGTTAGCCAGCCAGTCGGGATGAAGGACTTCTTTAATGAAGCCCGCCGCTAACAGCTTGGTTAATTCCTCCTTGATCGCATCCTTCCTGTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.40%	8.00%	0.44%	60.11%	NA
All Indica	2759	4.30%	4.40%	0.72%	90.58%	NA
All Japonica	1512	81.90%	14.20%	0.07%	3.84%	NA
Aus	269	2.60%	9.30%	0.00%	88.10%	NA
Indica I	595	6.10%	1.50%	0.84%	91.60%	NA
Indica II	465	4.70%	7.10%	0.86%	87.31%	NA
Indica III	913	2.40%	5.40%	0.33%	91.89%	NA
Indica Intermediate	786	5.00%	3.80%	1.02%	90.20%	NA
Temperate Japonica	767	97.40%	2.20%	0.00%	0.39%	NA
Tropical Japonica	504	61.70%	27.60%	0.00%	10.71%	NA
Japonica Intermediate	241	75.10%	24.10%	0.41%	0.41%	NA
VI/Aromatic	96	78.10%	10.40%	0.00%	11.46%	NA
Intermediate	90	50.00%	10.00%	0.00%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317222323	T -> A	LOC_Os03g30160.1	upstream_gene_variant ; 4782.0bp to feature; MODIFIER	silent_mutation	Average:26.657; most accessible tissue: Minghui63 young leaf, score: 69.4	N	N	N	N
vg0317222323	T -> A	LOC_Os03g30180.1	upstream_gene_variant ; 236.0bp to feature; MODIFIER	silent_mutation	Average:26.657; most accessible tissue: Minghui63 young leaf, score: 69.4	N	N	N	N
vg0317222323	T -> A	LOC_Os03g30170.1	downstream_gene_variant ; 257.0bp to feature; MODIFIER	silent_mutation	Average:26.657; most accessible tissue: Minghui63 young leaf, score: 69.4	N	N	N	N
vg0317222323	T -> A	LOC_Os03g30190.1	downstream_gene_variant ; 3050.0bp to feature; MODIFIER	silent_mutation	Average:26.657; most accessible tissue: Minghui63 young leaf, score: 69.4	N	N	N	N
vg0317222323	T -> A	LOC_Os03g30170-LOC_Os03g30180	intergenic_region ; MODIFIER	silent_mutation	Average:26.657; most accessible tissue: Minghui63 young leaf, score: 69.4	N	N	N	N
vg0317222323	T -> DEL	N	N	silent_mutation	Average:26.657; most accessible tissue: Minghui63 young leaf, score: 69.4	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317222323	NA	4.44E-08	mr1134	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317222323	NA	4.32E-06	mr1135	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317222323	NA	1.37E-07	mr1504	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317222323	NA	3.04E-08	mr1134_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317222323	NA	2.29E-06	mr1672_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251