Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317205386:

Variant ID: vg0317205386 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17205386
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

GGTCTTGTTAGAAGGATAGTAGCACTCTTTTTTGGCCTCTTCCCTCTTTAGAGCCTTTTTTATCCCACTAACGTTTCTTTTTTCCCCTGGCAGTGGCCCA[G/A]
CCATTGCGTTGTGTAACTGAAATTCCGTTTTCTTCTAATATATATGTAGGATCGCACAAGACCACATAAACCTATCAGAGGGGGATGAATGGTAGGGAAA

Reverse complement sequence

TTTCCCTACCATTCATCCCCCTCTGATAGGTTTATGTGGTCTTGTGCGATCCTACATATATATTAGAAGAAAACGGAATTTCAGTTACACAACGCAATGG[C/T]
TGGGCCACTGCCAGGGGAAAAAAGAAACGTTAGTGGGATAAAAAAGGCTCTAAAGAGGGAAGAGGCCAAAAAAGAGTGCTACTATCCTTCTAACAAGACC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.60%	44.00%	0.21%	0.17%	NA
All Indica	2759	90.70%	8.70%	0.33%	0.25%	NA
All Japonica	1512	3.90%	96.00%	0.07%	0.00%	NA
Aus	269	9.70%	90.30%	0.00%	0.00%	NA
Indica I	595	96.60%	2.00%	0.67%	0.67%	NA
Indica II	465	89.50%	10.30%	0.22%	0.00%	NA
Indica III	913	88.40%	11.40%	0.11%	0.11%	NA
Indica Intermediate	786	89.60%	9.80%	0.38%	0.25%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	11.10%	88.90%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	98.80%	0.41%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	41.10%	57.80%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317205386	G -> A	LOC_Os03g30130.3	downstream_gene_variant ; 1910.0bp to feature; MODIFIER	silent_mutation	Average:76.858; most accessible tissue: Minghui63 root, score: 81.14	N	N	N	N
vg0317205386	G -> A	LOC_Os03g30130.2	downstream_gene_variant ; 1907.0bp to feature; MODIFIER	silent_mutation	Average:76.858; most accessible tissue: Minghui63 root, score: 81.14	N	N	N	N
vg0317205386	G -> A	LOC_Os03g30130.1	downstream_gene_variant ; 1910.0bp to feature; MODIFIER	silent_mutation	Average:76.858; most accessible tissue: Minghui63 root, score: 81.14	N	N	N	N
vg0317205386	G -> A	LOC_Os03g30120-LOC_Os03g30130	intergenic_region ; MODIFIER	silent_mutation	Average:76.858; most accessible tissue: Minghui63 root, score: 81.14	N	N	N	N
vg0317205386	G -> DEL	N	N	silent_mutation	Average:76.858; most accessible tissue: Minghui63 root, score: 81.14	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317205386	NA	9.38E-11	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	1.09E-47	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	7.11E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	2.00E-11	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	1.33E-10	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	1.49E-11	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	1.05E-76	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	6.47E-07	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	3.82E-07	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	7.94E-14	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	2.05E-10	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	1.23E-31	mr1037_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	1.10E-13	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	9.63E-14	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	8.34E-60	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	5.64E-51	mr1121_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	2.47E-37	mr1129_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	2.55E-12	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	2.74E-13	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	4.58E-37	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	9.60E-39	mr1251_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	4.39E-21	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	5.71E-29	mr1270_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	1.58E-23	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	1.01E-23	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	4.51E-13	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	5.45E-39	mr1435_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	1.98E-09	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	1.07E-11	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	5.24E-07	NA	mr1567_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	1.40E-06	NA	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	1.92E-50	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	1.14E-06	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	2.67E-15	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	5.20E-39	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	4.28E-68	mr1798_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317205386	NA	7.50E-30	mr1932_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251