Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317137871:

Variant ID: vg0317137871 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17137871
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

ACCCGACTACAACCGTACAAGACGTTGCGTTGCGCCTTAGCGATCGATACACCTCTCCGTGGGTTGTTGATCTTGCCGGTACAAATCAACCTTATTCCTG[T/C]
AAGCAAATCGAAGAAACAAGCAAGAACAAGATAAAAGCAATCTGAATTGCAAATAGGAGTTAAATACGAATGATAAGTTGGGGTTCCGAAGAACAAGCAG

Reverse complement sequence

CTGCTTGTTCTTCGGAACCCCAACTTATCATTCGTATTTAACTCCTATTTGCAATTCAGATTGCTTTTATCTTGTTCTTGCTTGTTTCTTCGATTTGCTT[A/G]
CAGGAATAAGGTTGATTTGTACCGGCAAGATCAACAACCCACGGAGAGGTGTATCGATCGCTAAGGCGCAACGCAACGTCTTGTACGGTTGTAGTCGGGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.20%	11.40%	40.58%	8.80%	NA
All Indica	2759	11.50%	16.30%	57.34%	14.86%	NA
All Japonica	1512	96.20%	0.80%	3.04%	0.00%	NA
Aus	269	7.40%	19.70%	71.75%	1.12%	NA
Indica I	595	4.90%	17.30%	60.50%	17.31%	NA
Indica II	465	14.20%	11.00%	67.31%	7.53%	NA
Indica III	913	15.90%	19.10%	49.18%	15.88%	NA
Indica Intermediate	786	9.80%	15.50%	58.52%	16.16%	NA
Temperate Japonica	767	99.10%	0.40%	0.52%	0.00%	NA
Tropical Japonica	504	90.30%	1.60%	8.13%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	17.70%	11.50%	69.79%	1.04%	NA
Intermediate	90	51.10%	13.30%	33.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317137871	T -> C	LOC_Os03g30040.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:32.032; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0317137871	T -> C	LOC_Os03g30030.1	upstream_gene_variant ; 1984.0bp to feature; MODIFIER	silent_mutation	Average:32.032; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0317137871	T -> C	LOC_Os03g30050.1	upstream_gene_variant ; 3120.0bp to feature; MODIFIER	silent_mutation	Average:32.032; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N
vg0317137871	T -> DEL	N	N	silent_mutation	Average:32.032; most accessible tissue: Minghui63 flag leaf, score: 72.028	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317137871	NA	1.49E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	4.55E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	4.53E-11	mr1299_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	1.24E-08	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	1.33E-10	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	6.05E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	1.11E-07	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	2.00E-10	mr1700_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	2.29E-08	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	1.30E-11	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	1.55E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	3.30E-07	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	1.32E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	1.74E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	2.92E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	7.08E-06	mr1854_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871	NA	3.23E-07	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251