\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317137871:

Variant ID: vg0317137871 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17137871
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCGACTACAACCGTACAAGACGTTGCGTTGCGCCTTAGCGATCGATACACCTCTCCGTGGGTTGTTGATCTTGCCGGTACAAATCAACCTTATTCCTG[T/C]
AAGCAAATCGAAGAAACAAGCAAGAACAAGATAAAAGCAATCTGAATTGCAAATAGGAGTTAAATACGAATGATAAGTTGGGGTTCCGAAGAACAAGCAG

Reverse complement sequence

CTGCTTGTTCTTCGGAACCCCAACTTATCATTCGTATTTAACTCCTATTTGCAATTCAGATTGCTTTTATCTTGTTCTTGCTTGTTTCTTCGATTTGCTT[A/G]
CAGGAATAAGGTTGATTTGTACCGGCAAGATCAACAACCCACGGAGAGGTGTATCGATCGCTAAGGCGCAACGCAACGTCTTGTACGGTTGTAGTCGGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.20% 11.40% 40.58% 8.80% NA
All Indica  2759 11.50% 16.30% 57.34% 14.86% NA
All Japonica  1512 96.20% 0.80% 3.04% 0.00% NA
Aus  269 7.40% 19.70% 71.75% 1.12% NA
Indica I  595 4.90% 17.30% 60.50% 17.31% NA
Indica II  465 14.20% 11.00% 67.31% 7.53% NA
Indica III  913 15.90% 19.10% 49.18% 15.88% NA
Indica Intermediate  786 9.80% 15.50% 58.52% 16.16% NA
Temperate Japonica  767 99.10% 0.40% 0.52% 0.00% NA
Tropical Japonica  504 90.30% 1.60% 8.13% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 17.70% 11.50% 69.79% 1.04% NA
Intermediate  90 51.10% 13.30% 33.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317137871 T -> C LOC_Os03g30040.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:32.032; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0317137871 T -> C LOC_Os03g30030.1 upstream_gene_variant ; 1984.0bp to feature; MODIFIER silent_mutation Average:32.032; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0317137871 T -> C LOC_Os03g30050.1 upstream_gene_variant ; 3120.0bp to feature; MODIFIER silent_mutation Average:32.032; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0317137871 T -> DEL N N silent_mutation Average:32.032; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317137871 NA 1.49E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 4.55E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 4.53E-11 mr1299_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 1.24E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 1.33E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 6.05E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 1.11E-07 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 2.00E-10 mr1700_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 2.29E-08 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 1.30E-11 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 1.55E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 3.30E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 1.32E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 1.74E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 2.92E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 7.08E-06 mr1854_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137871 NA 3.23E-07 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251