\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317137506:

Variant ID: vg0317137506 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17137506
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCGTAGGTTCCGACGATAACAGAGACACGGAGGCGACGACGACTCTGGTATAAAACGTGACCAGAACTCGAAACTCTAAACGAACTAGACGCTAAGAC[T/C]
AGCAACACGACGAGACGATGCAACACAAAATTTAACAAAGCAAAAACTGAAAAGAACAATACAATGGCACAATATGGCTAGGTAAATGATACGGATTTTT

Reverse complement sequence

AAAAATCCGTATCATTTACCTAGCCATATTGTGCCATTGTATTGTTCTTTTCAGTTTTTGCTTTGTTAAATTTTGTGTTGCATCGTCTCGTCGTGTTGCT[A/G]
GTCTTAGCGTCTAGTTCGTTTAGAGTTTCGAGTTCTGGTCACGTTTTATACCAGAGTCGTCGTCGCCTCCGTGTCTCTGTTATCGTCGGAACCTACGAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 37.60% 0.53% 0.00% NA
All Indica  2759 90.00% 9.40% 0.62% 0.00% NA
All Japonica  1512 4.00% 95.80% 0.20% 0.00% NA
Aus  269 94.10% 5.60% 0.37% 0.00% NA
Indica I  595 97.00% 2.00% 1.01% 0.00% NA
Indica II  465 87.50% 12.00% 0.43% 0.00% NA
Indica III  913 85.20% 14.70% 0.11% 0.00% NA
Indica Intermediate  786 91.60% 7.40% 1.02% 0.00% NA
Temperate Japonica  767 0.70% 99.10% 0.26% 0.00% NA
Tropical Japonica  504 10.30% 89.70% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.30% 0.41% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 52.20% 43.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317137506 T -> C LOC_Os03g30030.1 upstream_gene_variant ; 1619.0bp to feature; MODIFIER silent_mutation Average:30.45; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N
vg0317137506 T -> C LOC_Os03g30050.1 upstream_gene_variant ; 3485.0bp to feature; MODIFIER silent_mutation Average:30.45; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N
vg0317137506 T -> C LOC_Os03g30040.1 downstream_gene_variant ; 301.0bp to feature; MODIFIER silent_mutation Average:30.45; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N
vg0317137506 T -> C LOC_Os03g30030-LOC_Os03g30040 intergenic_region ; MODIFIER silent_mutation Average:30.45; most accessible tissue: Minghui63 flag leaf, score: 55.068 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317137506 NA 1.54E-10 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137506 NA 1.04E-09 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137506 NA 2.31E-10 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137506 NA 4.91E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137506 NA 9.50E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137506 NA 1.58E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137506 NA 4.77E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137506 3.22E-07 3.22E-07 mr1382_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137506 NA 7.62E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137506 NA 2.11E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137506 NA 7.16E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137506 NA 7.35E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137506 NA 7.15E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137506 NA 6.86E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317137506 NA 2.70E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251