\
| Variant ID: vg0317132380 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17132380 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.21, others allele: 0.00, population size: 63. )
ATGGAGCTCTCTCACAAAATGTACTAGAGTTGTGGAGCTGGGTTTAGGCAGCTCCACAACTCCACTCTAGACTCAACTCCTGGAACAATATTTAGGAGCT[A/G]
GAGCTGTACCAAACAGACCCTATGTTTCACTCCAAGAAAAGAGTTGGAGTGAGTTGGGCCAAAATCTTTGTACAGGCCCAACTCGACAGTTCTCTTTCGT
ACGAAAGAGAACTGTCGAGTTGGGCCTGTACAAAGATTTTGGCCCAACTCACTCCAACTCTTTTCTTGGAGTGAAACATAGGGTCTGTTTGGTACAGCTC[T/C]
AGCTCCTAAATATTGTTCCAGGAGTTGAGTCTAGAGTGGAGTTGTGGAGCTGCCTAAACCCAGCTCCACAACTCTAGTACATTTTGTGAGAGAGCTCCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.20% | 37.50% | 0.28% | 0.02% | NA |
| All Indica | 2759 | 90.60% | 9.10% | 0.33% | 0.04% | NA |
| All Japonica | 1512 | 3.80% | 96.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 1.30% | 0.67% | 0.17% | NA |
| Indica II | 465 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.40% | 14.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.40% | 7.10% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.30% | 89.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 42.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317132380 | A -> DEL | N | N | silent_mutation | Average:65.152; most accessible tissue: Zhenshan97 flower, score: 77.563 | N | N | N | N |
| vg0317132380 | A -> G | LOC_Os03g30030.1 | downstream_gene_variant ; 1846.0bp to feature; MODIFIER | silent_mutation | Average:65.152; most accessible tissue: Zhenshan97 flower, score: 77.563 | N | N | N | N |
| vg0317132380 | A -> G | LOC_Os03g30020-LOC_Os03g30030 | intergenic_region ; MODIFIER | silent_mutation | Average:65.152; most accessible tissue: Zhenshan97 flower, score: 77.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317132380 | NA | 5.19E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 3.52E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 2.23E-40 | mr1243_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 1.87E-19 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 1.11E-09 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 9.24E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 1.72E-12 | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 3.37E-06 | mr1391_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 1.07E-16 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 1.06E-28 | mr1423_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 1.76E-24 | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 7.01E-26 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 1.61E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 1.58E-08 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 1.29E-08 | mr1700_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 2.30E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 3.20E-10 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 5.27E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 4.52E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 3.07E-14 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317132380 | NA | 1.04E-19 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |