\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317132380:

Variant ID: vg0317132380 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17132380
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.21, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGAGCTCTCTCACAAAATGTACTAGAGTTGTGGAGCTGGGTTTAGGCAGCTCCACAACTCCACTCTAGACTCAACTCCTGGAACAATATTTAGGAGCT[A/G]
GAGCTGTACCAAACAGACCCTATGTTTCACTCCAAGAAAAGAGTTGGAGTGAGTTGGGCCAAAATCTTTGTACAGGCCCAACTCGACAGTTCTCTTTCGT

Reverse complement sequence

ACGAAAGAGAACTGTCGAGTTGGGCCTGTACAAAGATTTTGGCCCAACTCACTCCAACTCTTTTCTTGGAGTGAAACATAGGGTCTGTTTGGTACAGCTC[T/C]
AGCTCCTAAATATTGTTCCAGGAGTTGAGTCTAGAGTGGAGTTGTGGAGCTGCCTAAACCCAGCTCCACAACTCTAGTACATTTTGTGAGAGAGCTCCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 37.50% 0.28% 0.02% NA
All Indica  2759 90.60% 9.10% 0.33% 0.04% NA
All Japonica  1512 3.80% 96.10% 0.07% 0.00% NA
Aus  269 93.70% 6.30% 0.00% 0.00% NA
Indica I  595 97.80% 1.30% 0.67% 0.17% NA
Indica II  465 88.40% 11.60% 0.00% 0.00% NA
Indica III  913 85.40% 14.50% 0.11% 0.00% NA
Indica Intermediate  786 92.40% 7.10% 0.51% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 10.30% 89.70% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 97.90% 0.41% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 54.40% 42.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317132380 A -> DEL N N silent_mutation Average:65.152; most accessible tissue: Zhenshan97 flower, score: 77.563 N N N N
vg0317132380 A -> G LOC_Os03g30030.1 downstream_gene_variant ; 1846.0bp to feature; MODIFIER silent_mutation Average:65.152; most accessible tissue: Zhenshan97 flower, score: 77.563 N N N N
vg0317132380 A -> G LOC_Os03g30020-LOC_Os03g30030 intergenic_region ; MODIFIER silent_mutation Average:65.152; most accessible tissue: Zhenshan97 flower, score: 77.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317132380 NA 5.19E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 3.52E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 2.23E-40 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 1.87E-19 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 1.11E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 9.24E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 1.72E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 3.37E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 1.07E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 1.06E-28 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 1.76E-24 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 7.01E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 1.61E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 1.58E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 1.29E-08 mr1700_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 2.30E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 3.20E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 5.27E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 4.52E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 3.07E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132380 NA 1.04E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251