Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317132280:

Variant ID: vg0317132280 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17132280
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGCTGATTAATCGGGTGTTATTTGATCACAGGTACATATGTATAGGCTTGTTTGGCACAGCTTCAACTCCAGCTCCACCAAAACTGGGAGTGGAGTTGG[A/G]
TGGAGCTCTCTCACAAAATGTACTAGAGTTGTGGAGCTGGGTTTAGGCAGCTCCACAACTCCACTCTAGACTCAACTCCTGGAACAATATTTAGGAGCTA

Reverse complement sequence

TAGCTCCTAAATATTGTTCCAGGAGTTGAGTCTAGAGTGGAGTTGTGGAGCTGCCTAAACCCAGCTCCACAACTCTAGTACATTTTGTGAGAGAGCTCCA[T/C]
CCAACTCCACTCCCAGTTTTGGTGGAGCTGGAGTTGAAGCTGTGCCAAACAAGCCTATACATATGTACCTGTGATCAAATAACACCCGATTAATCAGCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	37.40%	0.34%	0.00%	NA
All Indica	2759	90.60%	9.10%	0.36%	0.00%	NA
All Japonica	1512	3.90%	95.80%	0.26%	0.00%	NA
Aus	269	94.10%	5.90%	0.00%	0.00%	NA
Indica I	595	98.00%	1.20%	0.84%	0.00%	NA
Indica II	465	88.20%	11.60%	0.22%	0.00%	NA
Indica III	913	85.30%	14.60%	0.11%	0.00%	NA
Indica Intermediate	786	92.50%	7.10%	0.38%	0.00%	NA
Temperate Japonica	767	0.40%	99.50%	0.13%	0.00%	NA
Tropical Japonica	504	10.50%	89.50%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	97.50%	1.24%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	56.70%	41.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317132280	A -> G	LOC_Os03g30030.1	downstream_gene_variant ; 1946.0bp to feature; MODIFIER	silent_mutation	Average:66.594; most accessible tissue: Zhenshan97 flower, score: 75.657	N	N	N	N
vg0317132280	A -> G	LOC_Os03g30020-LOC_Os03g30030	intergenic_region ; MODIFIER	silent_mutation	Average:66.594; most accessible tissue: Zhenshan97 flower, score: 75.657	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317132280	NA	5.41E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	3.26E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	3.35E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	4.47E-21	mr1175_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	2.60E-41	mr1243_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	1.55E-09	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	1.81E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	5.25E-12	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	1.34E-06	mr1391_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	9.43E-24	mr1403_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	7.34E-16	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	6.87E-29	mr1423_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	3.61E-25	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	9.85E-20	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	4.24E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	1.36E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	4.94E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	4.20E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	2.44E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	2.62E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	5.34E-66	mr1828_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	1.78E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	4.89E-06	NA	mr1876_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	1.25E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317132280	NA	1.48E-20	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251