\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317087788:

Variant ID: vg0317087788 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17087788
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, A: 0.44, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


ATCAGTTGATTCCACTGCTTAGATGTGGCTATATATGGCAGTGTCAATAATAAATAGTTAGATCGTGGACAAATCTAACTAGATGAGTATTTGCTAAAAA[T/A]
TTTTTATATTTTTAACGCCTATAATTAATACTCTCTCCGTTTTTAAATATTTGACACCGTTGACTTTTTAACATATGTTTGACCGTTCGTCTTATTCAAA

Reverse complement sequence

TTTGAATAAGACGAACGGTCAAACATATGTTAAAAAGTCAACGGTGTCAAATATTTAAAAACGGAGAGAGTATTAATTATAGGCGTTAAAAATATAAAAA[A/T]
TTTTTAGCAAATACTCATCTAGTTAGATTTGTCCACGATCTAACTATTTATTATTGACACTGCCATATATAGCCACATCTAAGCAGTGGAATCAACTGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 39.10% 0.83% 0.00% NA
All Indica  2759 89.90% 9.80% 0.33% 0.00% NA
All Japonica  1512 4.10% 94.30% 1.59% 0.00% NA
Aus  269 90.70% 8.90% 0.37% 0.00% NA
Indica I  595 98.00% 1.30% 0.67% 0.00% NA
Indica II  465 88.00% 11.60% 0.43% 0.00% NA
Indica III  913 83.80% 16.10% 0.11% 0.00% NA
Indica Intermediate  786 91.90% 7.90% 0.25% 0.00% NA
Temperate Japonica  767 0.90% 97.70% 1.43% 0.00% NA
Tropical Japonica  504 10.70% 88.50% 0.79% 0.00% NA
Japonica Intermediate  241 0.40% 95.90% 3.73% 0.00% NA
VI/Aromatic  96 12.50% 86.50% 1.04% 0.00% NA
Intermediate  90 46.70% 48.90% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317087788 T -> A LOC_Os03g29980.2 upstream_gene_variant ; 4332.0bp to feature; MODIFIER silent_mutation Average:70.75; most accessible tissue: Zhenshan97 flag leaf, score: 83.84 N N N N
vg0317087788 T -> A LOC_Os03g29960.1 downstream_gene_variant ; 3748.0bp to feature; MODIFIER silent_mutation Average:70.75; most accessible tissue: Zhenshan97 flag leaf, score: 83.84 N N N N
vg0317087788 T -> A LOC_Os03g29970.1 downstream_gene_variant ; 406.0bp to feature; MODIFIER silent_mutation Average:70.75; most accessible tissue: Zhenshan97 flag leaf, score: 83.84 N N N N
vg0317087788 T -> A LOC_Os03g29970-LOC_Os03g29980 intergenic_region ; MODIFIER silent_mutation Average:70.75; most accessible tissue: Zhenshan97 flag leaf, score: 83.84 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0317087788 T A 0.0 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317087788 2.15E-07 NA mr1026 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 3.17E-08 NA mr1161 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 3.19E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 1.43E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 8.39E-10 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 2.92E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 1.16E-15 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 1.03E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 3.70E-20 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 1.21E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 4.50E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 6.85E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 1.43E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 7.47E-11 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 3.65E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 1.80E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 1.97E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317087788 NA 4.58E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251