\
| Variant ID: vg0317064370 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17064370 |
| Reference Allele: A | Alternative Allele: G,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 182. )
GTTTGCTAACCTTGAAAAGTGCATCTTTTGCACGGAACGAGTTTCATTTCTTGGATATATTGTTACTCCACAGGGAATTGAGGTGGATGAGATGAAAATT[A/G,C]
AAGCCATAAAGAGTTGGCCGGTTCCCCAAACCATCACACAGGTGAGGAGTTTTCTTGGTCTTGCAGGATTCTATCATCGTTTCGTCAAAGATTTTAGTAC
GTACTAAAATCTTTGACGAAACGATGATAGAATCCTGCAAGACCAAGAAAACTCCTCACCTGTGTGATGGTTTGGGGAACCGGCCAACTCTTTATGGCTT[T/C,G]
AATTTTCATCTCATCCACCTCAATTCCCTGTGGAGTAACAATATATCCAAGAAATGAAACTCGTTCCGTGCAAAAGATGCACTTTTCAAGGTTAGCAAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.10% | 28.10% | 4.93% | 5.82% | C: 0.02% |
| All Indica | 2759 | 88.50% | 7.40% | 1.52% | 2.57% | C: 0.04% |
| All Japonica | 1512 | 4.10% | 70.60% | 11.97% | 13.36% | NA |
| Aus | 269 | 94.40% | 5.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.80% | 1.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 85.80% | 6.50% | 3.01% | 4.73% | NA |
| Indica III | 913 | 80.90% | 13.30% | 1.31% | 4.38% | C: 0.11% |
| Indica Intermediate | 786 | 91.70% | 5.50% | 1.65% | 1.15% | NA |
| Temperate Japonica | 767 | 0.30% | 66.90% | 15.38% | 17.47% | NA |
| Tropical Japonica | 504 | 11.30% | 77.20% | 6.35% | 5.16% | NA |
| Japonica Intermediate | 241 | 1.20% | 68.50% | 12.86% | 17.43% | NA |
| VI/Aromatic | 96 | 83.30% | 15.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 31.10% | 8.89% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317064370 | A -> C | LOC_Os03g29940.1 | missense_variant ; p.Lys733Gln; MODERATE | nonsynonymous_codon ; K733Q | Average:30.314; most accessible tissue: Minghui63 flag leaf, score: 53.617 | benign |
0.968 |
TOLERATED | 0.08 |
| vg0317064370 | A -> DEL | LOC_Os03g29940.1 | N | frameshift_variant | Average:30.314; most accessible tissue: Minghui63 flag leaf, score: 53.617 | N | N | N | N |
| vg0317064370 | A -> G | LOC_Os03g29940.1 | missense_variant ; p.Lys733Glu; MODERATE | nonsynonymous_codon ; K733E | Average:30.314; most accessible tissue: Minghui63 flag leaf, score: 53.617 | benign |
0.498 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317064370 | 1.10E-06 | NA | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | 2.04E-06 | NA | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | 1.21E-06 | NA | mr1141_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | 7.01E-06 | NA | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | NA | 2.98E-09 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | NA | 9.27E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | NA | 8.82E-12 | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | 8.96E-06 | NA | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | NA | 6.72E-06 | mr1391_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | NA | 9.92E-18 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | NA | 3.85E-25 | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | NA | 5.11E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | NA | 2.71E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | NA | 7.13E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | NA | 1.80E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | NA | 2.18E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | NA | 2.35E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | NA | 6.12E-14 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317064370 | NA | 4.85E-21 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |