\
| Variant ID: vg0317039059 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17039059 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, C: 0.27, others allele: 0.00, population size: 93. )
ATTTTATAAATGAGAGCTAATCCGCGAGACGAATTTTTTAAACCTAATTAATCTATAATTATCAAAAGTTTACTGTAGCATCACATTGTCAAAATCATGG[T/C]
GTAATTAGATTCAAAATATTCGTCTCGCGAATTAGTCCAATGTTATGGAATGGGTTTTGTAATTAGTGTTTAATACTTTAAATTTAATATCCAAACATCC
GGATGTTTGGATATTAAATTTAAAGTATTAAACACTAATTACAAAACCCATTCCATAACATTGGACTAATTCGCGAGACGAATATTTTGAATCTAATTAC[A/G]
CCATGATTTTGACAATGTGATGCTACAGTAAACTTTTGATAATTATAGATTAATTAGGTTTAAAAAATTCGTCTCGCGGATTAGCTCTCATTTATAAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.80% | 39.30% | 0.02% | 1.82% | NA |
| All Indica | 2759 | 86.60% | 13.30% | 0.00% | 0.18% | NA |
| All Japonica | 1512 | 4.20% | 95.60% | 0.00% | 0.20% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.20% | 21.40% | 0.00% | 0.44% | NA |
| Indica Intermediate | 786 | 86.80% | 13.10% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 11.90% | 88.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 98.30% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 16.70% | 8.30% | 0.00% | 75.00% | NA |
| Intermediate | 90 | 52.20% | 41.10% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317039059 | T -> C | LOC_Os03g29900.1 | upstream_gene_variant ; 3833.0bp to feature; MODIFIER | silent_mutation | Average:67.912; most accessible tissue: Callus, score: 77.591 | N | N | N | N |
| vg0317039059 | T -> C | LOC_Os03g29910.1 | upstream_gene_variant ; 239.0bp to feature; MODIFIER | silent_mutation | Average:67.912; most accessible tissue: Callus, score: 77.591 | N | N | N | N |
| vg0317039059 | T -> C | LOC_Os03g29910.2 | upstream_gene_variant ; 239.0bp to feature; MODIFIER | silent_mutation | Average:67.912; most accessible tissue: Callus, score: 77.591 | N | N | N | N |
| vg0317039059 | T -> C | LOC_Os03g29900-LOC_Os03g29910 | intergenic_region ; MODIFIER | silent_mutation | Average:67.912; most accessible tissue: Callus, score: 77.591 | N | N | N | N |
| vg0317039059 | T -> DEL | N | N | silent_mutation | Average:67.912; most accessible tissue: Callus, score: 77.591 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317039059 | NA | 3.46E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0317039059 | 8.58E-07 | 8.03E-07 | mr1180 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317039059 | NA | 6.30E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317039059 | NA | 1.26E-11 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317039059 | NA | 3.28E-07 | mr1489 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317039059 | NA | 7.98E-08 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317039059 | NA | 3.42E-07 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317039059 | 5.53E-06 | NA | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317039059 | NA | 5.07E-34 | mr1944 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |