Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317039059:

Variant ID: vg0317039059 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17039059
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, C: 0.27, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTTATAAATGAGAGCTAATCCGCGAGACGAATTTTTTAAACCTAATTAATCTATAATTATCAAAAGTTTACTGTAGCATCACATTGTCAAAATCATGG[T/C]
GTAATTAGATTCAAAATATTCGTCTCGCGAATTAGTCCAATGTTATGGAATGGGTTTTGTAATTAGTGTTTAATACTTTAAATTTAATATCCAAACATCC

Reverse complement sequence

GGATGTTTGGATATTAAATTTAAAGTATTAAACACTAATTACAAAACCCATTCCATAACATTGGACTAATTCGCGAGACGAATATTTTGAATCTAATTAC[A/G]
CCATGATTTTGACAATGTGATGCTACAGTAAACTTTTGATAATTATAGATTAATTAGGTTTAAAAAATTCGTCTCGCGGATTAGCTCTCATTTATAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	39.30%	0.02%	1.82%	NA
All Indica	2759	86.60%	13.30%	0.00%	0.18%	NA
All Japonica	1512	4.20%	95.60%	0.00%	0.20%	NA
Aus	269	98.90%	0.70%	0.00%	0.37%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	87.10%	12.90%	0.00%	0.00%	NA
Indica III	913	78.20%	21.40%	0.00%	0.44%	NA
Indica Intermediate	786	86.80%	13.10%	0.00%	0.13%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	11.90%	88.10%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	98.30%	0.00%	1.24%	NA
VI/Aromatic	96	16.70%	8.30%	0.00%	75.00%	NA
Intermediate	90	52.20%	41.10%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317039059	T -> C	LOC_Os03g29900.1	upstream_gene_variant ; 3833.0bp to feature; MODIFIER	silent_mutation	Average:67.912; most accessible tissue: Callus, score: 77.591	N	N	N	N
vg0317039059	T -> C	LOC_Os03g29910.1	upstream_gene_variant ; 239.0bp to feature; MODIFIER	silent_mutation	Average:67.912; most accessible tissue: Callus, score: 77.591	N	N	N	N
vg0317039059	T -> C	LOC_Os03g29910.2	upstream_gene_variant ; 239.0bp to feature; MODIFIER	silent_mutation	Average:67.912; most accessible tissue: Callus, score: 77.591	N	N	N	N
vg0317039059	T -> C	LOC_Os03g29900-LOC_Os03g29910	intergenic_region ; MODIFIER	silent_mutation	Average:67.912; most accessible tissue: Callus, score: 77.591	N	N	N	N
vg0317039059	T -> DEL	N	N	silent_mutation	Average:67.912; most accessible tissue: Callus, score: 77.591	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317039059	NA	3.46E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317039059	8.58E-07	8.03E-07	mr1180	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317039059	NA	6.30E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317039059	NA	1.26E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317039059	NA	3.28E-07	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317039059	NA	7.98E-08	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317039059	NA	3.42E-07	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317039059	5.53E-06	NA	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317039059	NA	5.07E-34	mr1944	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251