\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317039059:

Variant ID: vg0317039059 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17039059
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, C: 0.27, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTATAAATGAGAGCTAATCCGCGAGACGAATTTTTTAAACCTAATTAATCTATAATTATCAAAAGTTTACTGTAGCATCACATTGTCAAAATCATGG[T/C]
GTAATTAGATTCAAAATATTCGTCTCGCGAATTAGTCCAATGTTATGGAATGGGTTTTGTAATTAGTGTTTAATACTTTAAATTTAATATCCAAACATCC

Reverse complement sequence

GGATGTTTGGATATTAAATTTAAAGTATTAAACACTAATTACAAAACCCATTCCATAACATTGGACTAATTCGCGAGACGAATATTTTGAATCTAATTAC[A/G]
CCATGATTTTGACAATGTGATGCTACAGTAAACTTTTGATAATTATAGATTAATTAGGTTTAAAAAATTCGTCTCGCGGATTAGCTCTCATTTATAAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 39.30% 0.02% 1.82% NA
All Indica  2759 86.60% 13.30% 0.00% 0.18% NA
All Japonica  1512 4.20% 95.60% 0.00% 0.20% NA
Aus  269 98.90% 0.70% 0.00% 0.37% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 87.10% 12.90% 0.00% 0.00% NA
Indica III  913 78.20% 21.40% 0.00% 0.44% NA
Indica Intermediate  786 86.80% 13.10% 0.00% 0.13% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 11.90% 88.10% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 98.30% 0.00% 1.24% NA
VI/Aromatic  96 16.70% 8.30% 0.00% 75.00% NA
Intermediate  90 52.20% 41.10% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317039059 T -> C LOC_Os03g29900.1 upstream_gene_variant ; 3833.0bp to feature; MODIFIER silent_mutation Average:67.912; most accessible tissue: Callus, score: 77.591 N N N N
vg0317039059 T -> C LOC_Os03g29910.1 upstream_gene_variant ; 239.0bp to feature; MODIFIER silent_mutation Average:67.912; most accessible tissue: Callus, score: 77.591 N N N N
vg0317039059 T -> C LOC_Os03g29910.2 upstream_gene_variant ; 239.0bp to feature; MODIFIER silent_mutation Average:67.912; most accessible tissue: Callus, score: 77.591 N N N N
vg0317039059 T -> C LOC_Os03g29900-LOC_Os03g29910 intergenic_region ; MODIFIER silent_mutation Average:67.912; most accessible tissue: Callus, score: 77.591 N N N N
vg0317039059 T -> DEL N N silent_mutation Average:67.912; most accessible tissue: Callus, score: 77.591 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317039059 NA 3.46E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317039059 8.58E-07 8.03E-07 mr1180 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317039059 NA 6.30E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317039059 NA 1.26E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317039059 NA 3.28E-07 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317039059 NA 7.98E-08 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317039059 NA 3.42E-07 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317039059 5.53E-06 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317039059 NA 5.07E-34 mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251