Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317037719:

Variant ID: vg0317037719 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17037719
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

GACGTCAGCGTCCGATTTACGTGCAAAACTACTTTTAAATTGATTTTTCTCTTAAATTTCTTATCCAAATCATGATTCGATTACACCATTAAATTCTTTG[T/C]
AATTAAATCTTCAAAACAAGACCACACATGGATATATTCCGGTGAAAAAAATAGCTTATTATTGAATTATTTTTAAATGTTGCACGATGTTCCACCAGGT

Reverse complement sequence

ACCTGGTGGAACATCGTGCAACATTTAAAAATAATTCAATAATAAGCTATTTTTTTCACCGGAATATATCCATGTGTGGTCTTGTTTTGAAGATTTAATT[A/G]
CAAAGAATTTAATGGTGTAATCGAATCATGATTTGGATAAGAAATTTAAGAGAAAAATCAATTTAAAAGTAGTTTTGCACGTAAATCGGACGCTGACGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.70%	36.50%	0.38%	1.44%	NA
All Indica	2759	85.00%	14.70%	0.18%	0.11%	NA
All Japonica	1512	15.70%	83.90%	0.26%	0.07%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	96.10%	3.90%	0.00%	0.00%	NA
Indica II	465	87.70%	12.30%	0.00%	0.00%	NA
Indica III	913	77.40%	22.10%	0.22%	0.22%	NA
Indica Intermediate	786	83.80%	15.60%	0.38%	0.13%	NA
Temperate Japonica	767	21.90%	78.00%	0.13%	0.00%	NA
Tropical Japonica	504	12.10%	87.90%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	94.60%	1.24%	0.41%	NA
VI/Aromatic	96	17.70%	11.50%	8.33%	62.50%	NA
Intermediate	90	55.60%	40.00%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317037719	T -> C	LOC_Os03g29900.1	upstream_gene_variant ; 2493.0bp to feature; MODIFIER	silent_mutation	Average:45.493; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0317037719	T -> C	LOC_Os03g29910.1	upstream_gene_variant ; 1579.0bp to feature; MODIFIER	silent_mutation	Average:45.493; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0317037719	T -> C	LOC_Os03g29910.2	upstream_gene_variant ; 1579.0bp to feature; MODIFIER	silent_mutation	Average:45.493; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0317037719	T -> C	LOC_Os03g29900-LOC_Os03g29910	intergenic_region ; MODIFIER	silent_mutation	Average:45.493; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0317037719	T -> DEL	N	N	silent_mutation	Average:45.493; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317037719	3.91E-06	3.08E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	2.16E-06	NA	mr1183	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	NA	5.18E-10	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	1.16E-06	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	1.11E-07	1.19E-10	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	4.80E-06	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	1.74E-06	5.10E-09	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	3.18E-06	3.18E-06	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	NA	6.00E-07	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	3.25E-06	NA	mr1503	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	NA	2.24E-06	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	NA	5.66E-09	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	3.77E-07	1.22E-10	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	7.16E-08	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	1.26E-07	2.42E-10	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	NA	2.65E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	NA	1.90E-18	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	7.41E-07	NA	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	1.83E-06	5.95E-07	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	NA	1.25E-07	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	NA	1.23E-06	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	NA	5.24E-07	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	NA	3.85E-08	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719	NA	4.82E-06	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251