\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317037719:

Variant ID: vg0317037719 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17037719
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GACGTCAGCGTCCGATTTACGTGCAAAACTACTTTTAAATTGATTTTTCTCTTAAATTTCTTATCCAAATCATGATTCGATTACACCATTAAATTCTTTG[T/C]
AATTAAATCTTCAAAACAAGACCACACATGGATATATTCCGGTGAAAAAAATAGCTTATTATTGAATTATTTTTAAATGTTGCACGATGTTCCACCAGGT

Reverse complement sequence

ACCTGGTGGAACATCGTGCAACATTTAAAAATAATTCAATAATAAGCTATTTTTTTCACCGGAATATATCCATGTGTGGTCTTGTTTTGAAGATTTAATT[A/G]
CAAAGAATTTAATGGTGTAATCGAATCATGATTTGGATAAGAAATTTAAGAGAAAAATCAATTTAAAAGTAGTTTTGCACGTAAATCGGACGCTGACGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 36.50% 0.38% 1.44% NA
All Indica  2759 85.00% 14.70% 0.18% 0.11% NA
All Japonica  1512 15.70% 83.90% 0.26% 0.07% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 87.70% 12.30% 0.00% 0.00% NA
Indica III  913 77.40% 22.10% 0.22% 0.22% NA
Indica Intermediate  786 83.80% 15.60% 0.38% 0.13% NA
Temperate Japonica  767 21.90% 78.00% 0.13% 0.00% NA
Tropical Japonica  504 12.10% 87.90% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 94.60% 1.24% 0.41% NA
VI/Aromatic  96 17.70% 11.50% 8.33% 62.50% NA
Intermediate  90 55.60% 40.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317037719 T -> C LOC_Os03g29900.1 upstream_gene_variant ; 2493.0bp to feature; MODIFIER silent_mutation Average:45.493; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0317037719 T -> C LOC_Os03g29910.1 upstream_gene_variant ; 1579.0bp to feature; MODIFIER silent_mutation Average:45.493; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0317037719 T -> C LOC_Os03g29910.2 upstream_gene_variant ; 1579.0bp to feature; MODIFIER silent_mutation Average:45.493; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0317037719 T -> C LOC_Os03g29900-LOC_Os03g29910 intergenic_region ; MODIFIER silent_mutation Average:45.493; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0317037719 T -> DEL N N silent_mutation Average:45.493; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317037719 3.91E-06 3.08E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 2.16E-06 NA mr1183 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 NA 5.18E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 1.16E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 1.11E-07 1.19E-10 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 4.80E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 1.74E-06 5.10E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 3.18E-06 3.18E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 NA 6.00E-07 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 3.25E-06 NA mr1503 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 NA 2.24E-06 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 NA 5.66E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 3.77E-07 1.22E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 7.16E-08 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 1.26E-07 2.42E-10 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 NA 2.65E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 NA 1.90E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 7.41E-07 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 1.83E-06 5.95E-07 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 NA 1.25E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 NA 1.23E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 NA 5.24E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 NA 3.85E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037719 NA 4.82E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251