\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317037608:

Variant ID: vg0317037608 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17037608
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


AGCAAGGGAAAGTGCTGGCTTCTCTTAGACCGTTAGACGTCGACCGTTGGGAGAGAACTACGCGTCGGACGTCCGATGTTTTAGGGAAAAATCGGACGCT[G/A]
ACGTCAGCATGACGTCAGCGTCCGATTTACGTGCAAAACTACTTTTAAATTGATTTTTCTCTTAAATTTCTTATCCAAATCATGATTCGATTACACCATT

Reverse complement sequence

AATGGTGTAATCGAATCATGATTTGGATAAGAAATTTAAGAGAAAAATCAATTTAAAAGTAGTTTTGCACGTAAATCGGACGCTGACGTCATGCTGACGT[C/T]
AGCGTCCGATTTTTCCCTAAAACATCGGACGTCCGACGCGTAGTTCTCTCCCAACGGTCGACGTCTAACGGTCTAAGAGAAGCCAGCACTTTCCCTTGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.60% 48.80% 0.95% 0.70% NA
All Indica  2759 82.30% 17.40% 0.18% 0.11% NA
All Japonica  1512 0.60% 99.30% 0.13% 0.00% NA
Aus  269 6.70% 92.90% 0.37% 0.00% NA
Indica I  595 94.80% 5.00% 0.17% 0.00% NA
Indica II  465 87.10% 12.90% 0.00% 0.00% NA
Indica III  913 74.90% 24.60% 0.22% 0.22% NA
Indica Intermediate  786 78.60% 21.00% 0.25% 0.13% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 98.80% 0.83% 0.00% NA
VI/Aromatic  96 9.40% 26.00% 34.38% 30.21% NA
Intermediate  90 41.10% 53.30% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317037608 G -> A LOC_Os03g29900.1 upstream_gene_variant ; 2382.0bp to feature; MODIFIER silent_mutation Average:56.322; most accessible tissue: Zhenshan97 flower, score: 79.365 N N N N
vg0317037608 G -> A LOC_Os03g29910.1 upstream_gene_variant ; 1690.0bp to feature; MODIFIER silent_mutation Average:56.322; most accessible tissue: Zhenshan97 flower, score: 79.365 N N N N
vg0317037608 G -> A LOC_Os03g29910.2 upstream_gene_variant ; 1690.0bp to feature; MODIFIER silent_mutation Average:56.322; most accessible tissue: Zhenshan97 flower, score: 79.365 N N N N
vg0317037608 G -> A LOC_Os03g29900-LOC_Os03g29910 intergenic_region ; MODIFIER silent_mutation Average:56.322; most accessible tissue: Zhenshan97 flower, score: 79.365 N N N N
vg0317037608 G -> DEL N N silent_mutation Average:56.322; most accessible tissue: Zhenshan97 flower, score: 79.365 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317037608 NA 2.71E-34 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608 NA 6.73E-28 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608 NA 3.23E-34 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608 NA 2.03E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608 1.18E-06 2.65E-15 mr1183 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608 8.35E-06 NA mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608 7.87E-06 1.96E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608 NA 4.61E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608 NA 3.21E-06 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608 NA 1.43E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608 NA 2.07E-32 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608 NA 1.64E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608 NA 2.00E-21 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251