Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0317037608:

Variant ID: vg0317037608 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17037608
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

AGCAAGGGAAAGTGCTGGCTTCTCTTAGACCGTTAGACGTCGACCGTTGGGAGAGAACTACGCGTCGGACGTCCGATGTTTTAGGGAAAAATCGGACGCT[G/A]
ACGTCAGCATGACGTCAGCGTCCGATTTACGTGCAAAACTACTTTTAAATTGATTTTTCTCTTAAATTTCTTATCCAAATCATGATTCGATTACACCATT

Reverse complement sequence

AATGGTGTAATCGAATCATGATTTGGATAAGAAATTTAAGAGAAAAATCAATTTAAAAGTAGTTTTGCACGTAAATCGGACGCTGACGTCATGCTGACGT[C/T]
AGCGTCCGATTTTTCCCTAAAACATCGGACGTCCGACGCGTAGTTCTCTCCCAACGGTCGACGTCTAACGGTCTAAGAGAAGCCAGCACTTTCCCTTGCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.60%	48.80%	0.95%	0.70%	NA
All Indica	2759	82.30%	17.40%	0.18%	0.11%	NA
All Japonica	1512	0.60%	99.30%	0.13%	0.00%	NA
Aus	269	6.70%	92.90%	0.37%	0.00%	NA
Indica I	595	94.80%	5.00%	0.17%	0.00%	NA
Indica II	465	87.10%	12.90%	0.00%	0.00%	NA
Indica III	913	74.90%	24.60%	0.22%	0.22%	NA
Indica Intermediate	786	78.60%	21.00%	0.25%	0.13%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	98.80%	0.83%	0.00%	NA
VI/Aromatic	96	9.40%	26.00%	34.38%	30.21%	NA
Intermediate	90	41.10%	53.30%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317037608	G -> A	LOC_Os03g29900.1	upstream_gene_variant ; 2382.0bp to feature; MODIFIER	silent_mutation	Average:56.322; most accessible tissue: Zhenshan97 flower, score: 79.365	N	N	N	N
vg0317037608	G -> A	LOC_Os03g29910.1	upstream_gene_variant ; 1690.0bp to feature; MODIFIER	silent_mutation	Average:56.322; most accessible tissue: Zhenshan97 flower, score: 79.365	N	N	N	N
vg0317037608	G -> A	LOC_Os03g29910.2	upstream_gene_variant ; 1690.0bp to feature; MODIFIER	silent_mutation	Average:56.322; most accessible tissue: Zhenshan97 flower, score: 79.365	N	N	N	N
vg0317037608	G -> A	LOC_Os03g29900-LOC_Os03g29910	intergenic_region ; MODIFIER	silent_mutation	Average:56.322; most accessible tissue: Zhenshan97 flower, score: 79.365	N	N	N	N
vg0317037608	G -> DEL	N	N	silent_mutation	Average:56.322; most accessible tissue: Zhenshan97 flower, score: 79.365	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317037608	NA	2.71E-34	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608	NA	6.73E-28	mr1037	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608	NA	3.23E-34	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608	NA	2.03E-10	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608	1.18E-06	2.65E-15	mr1183	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608	8.35E-06	NA	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608	7.87E-06	1.96E-14	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608	NA	4.61E-11	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608	NA	3.21E-06	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608	NA	1.43E-09	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608	NA	2.07E-32	mr1037_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608	NA	1.64E-16	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317037608	NA	2.00E-21	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251