\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317023117:

Variant ID: vg0317023117 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17023117
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTCGGCCAAAAGAGCTTGGGGTTCGTACTTTTTGCATTTGGGCCCCTTGCCGCCCCAAGGTACCCGGATGCAAAAAGTATCGCCAAATGATTTTTCTA[T/C]
GTTATGTTAATAATAATTAAAGAAGTATTTATTGGTAAAACTTGTTAATATTGTTATAAAAATGTATTGAAATTGGTTGTTTCGCAATTTCATATATTAA

Reverse complement sequence

TTAATATATGAAATTGCGAAACAACCAATTTCAATACATTTTTATAACAATATTAACAAGTTTTACCAATAAATACTTCTTTAATTATTATTAACATAAC[A/G]
TAGAAAAATCATTTGGCGATACTTTTTGCATCCGGGTACCTTGGGGCGGCAAGGGGCCCAAATGCAAAAAGTACGAACCCCAAGCTCTTTTGGCCGACAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.00% 3.70% 0.06% 1.25% NA
All Indica  2759 99.90% 0.00% 0.00% 0.07% NA
All Japonica  1512 88.40% 11.50% 0.07% 0.07% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 99.90% 0.00% 0.00% 0.13% NA
Temperate Japonica  767 78.20% 21.60% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.30% 0.00% 0.41% NA
VI/Aromatic  96 43.80% 1.00% 2.08% 53.12% NA
Intermediate  90 94.40% 1.10% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317023117 T -> C LOC_Os03g29864.1 upstream_gene_variant ; 545.0bp to feature; MODIFIER silent_mutation Average:71.441; most accessible tissue: Zhenshan97 flag leaf, score: 86.23 N N N N
vg0317023117 T -> C LOC_Os03g29880.1 downstream_gene_variant ; 1610.0bp to feature; MODIFIER silent_mutation Average:71.441; most accessible tissue: Zhenshan97 flag leaf, score: 86.23 N N N N
vg0317023117 T -> C LOC_Os03g29864-LOC_Os03g29880 intergenic_region ; MODIFIER silent_mutation Average:71.441; most accessible tissue: Zhenshan97 flag leaf, score: 86.23 N N N N
vg0317023117 T -> DEL N N silent_mutation Average:71.441; most accessible tissue: Zhenshan97 flag leaf, score: 86.23 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317023117 NA 2.81E-18 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317023117 9.51E-14 NA mr1210 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 2.96E-08 8.84E-12 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 6.52E-12 NA mr1305 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 6.83E-07 1.80E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 5.07E-07 NA mr1409 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 6.18E-07 6.18E-07 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 4.48E-11 1.31E-11 mr1585 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 9.07E-08 6.77E-12 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 3.78E-15 NA mr1586 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 1.42E-08 1.11E-11 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 1.24E-07 NA mr1765 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 NA 8.73E-08 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 3.73E-06 NA mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 NA 3.31E-06 mr1793 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 2.03E-09 NA mr1305_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 2.57E-06 1.57E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 7.65E-08 4.68E-09 mr1559_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 NA 3.65E-06 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 2.91E-09 9.23E-13 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 3.65E-06 2.02E-11 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 NA 5.49E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 2.85E-06 2.86E-06 mr1703_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 3.17E-06 NA mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317023117 NA 3.96E-08 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251