\
| Variant ID: vg0316990859 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16990859 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.24, others allele: 0.00, population size: 200. )
TCAAATAAACAAAATGTATATGAATCAAAAGGTGACAAATAAGGTATCTAAACAAGATATAAGGTCACCAACTAAATCAATTAAGCATGCAAGTAGATCG[G/A]
GTAAAAACAAGCTCAAGCACAATATGAGAGAATGCACAAATGGGCAAACTAAGAGAGGAGACGCGTGATTTGTTTTCCGAAGTTCGGATCCACGGATCCT
AGGATCCGTGGATCCGAACTTCGGAAAACAAATCACGCGTCTCCTCTCTTAGTTTGCCCATTTGTGCATTCTCTCATATTGTGCTTGAGCTTGTTTTTAC[C/T]
CGATCTACTTGCATGCTTAATTGATTTAGTTGGTGACCTTATATCTTGTTTAGATACCTTATTTGTCACCTTTTGATTCATATACATTTTGTTTATTTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.50% | 45.30% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 35.30% | 64.50% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 4.90% | 95.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 74.40% | 25.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 32.00% | 67.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 38.90% | 60.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 88.70% | 11.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 30.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316990859 | G -> A | LOC_Os03g29790.1 | upstream_gene_variant ; 2415.0bp to feature; MODIFIER | silent_mutation | Average:33.49; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0316990859 | G -> A | LOC_Os03g29810.1 | upstream_gene_variant ; 3409.0bp to feature; MODIFIER | silent_mutation | Average:33.49; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0316990859 | G -> A | LOC_Os03g29790-LOC_Os03g29810 | intergenic_region ; MODIFIER | silent_mutation | Average:33.49; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316990859 | NA | 2.97E-06 | Grain_weight | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0316990859 | NA | 7.34E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 2.21E-07 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 2.53E-06 | mr1297 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 2.74E-11 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 4.52E-06 | mr1351 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 5.03E-06 | mr1374 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 5.37E-07 | mr1433 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 4.27E-06 | mr1434 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 1.64E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | 8.65E-06 | 8.64E-06 | mr1501 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 1.06E-06 | mr1512 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 4.57E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 1.86E-06 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 1.76E-08 | mr1607 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 2.33E-06 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 1.02E-08 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 4.54E-08 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | 3.30E-06 | 7.33E-11 | mr1776 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | 8.23E-06 | 8.23E-06 | mr1776 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316990859 | NA | 5.61E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |