\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316990859:

Variant ID: vg0316990859 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16990859
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.24, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAATAAACAAAATGTATATGAATCAAAAGGTGACAAATAAGGTATCTAAACAAGATATAAGGTCACCAACTAAATCAATTAAGCATGCAAGTAGATCG[G/A]
GTAAAAACAAGCTCAAGCACAATATGAGAGAATGCACAAATGGGCAAACTAAGAGAGGAGACGCGTGATTTGTTTTCCGAAGTTCGGATCCACGGATCCT

Reverse complement sequence

AGGATCCGTGGATCCGAACTTCGGAAAACAAATCACGCGTCTCCTCTCTTAGTTTGCCCATTTGTGCATTCTCTCATATTGTGCTTGAGCTTGTTTTTAC[C/T]
CGATCTACTTGCATGCTTAATTGATTTAGTTGGTGACCTTATATCTTGTTTAGATACCTTATTTGTCACCTTTTGATTCATATACATTTTGTTTATTTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 45.30% 0.17% 0.00% NA
All Indica  2759 35.30% 64.50% 0.22% 0.00% NA
All Japonica  1512 96.10% 3.90% 0.00% 0.00% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 4.90% 95.00% 0.17% 0.00% NA
Indica II  465 74.40% 25.20% 0.43% 0.00% NA
Indica III  913 32.00% 67.80% 0.22% 0.00% NA
Indica Intermediate  786 38.90% 60.90% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 88.70% 11.30% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 67.80% 30.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316990859 G -> A LOC_Os03g29790.1 upstream_gene_variant ; 2415.0bp to feature; MODIFIER silent_mutation Average:33.49; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0316990859 G -> A LOC_Os03g29810.1 upstream_gene_variant ; 3409.0bp to feature; MODIFIER silent_mutation Average:33.49; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0316990859 G -> A LOC_Os03g29790-LOC_Os03g29810 intergenic_region ; MODIFIER silent_mutation Average:33.49; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316990859 NA 2.97E-06 Grain_weight Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316990859 NA 7.34E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 2.21E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 2.53E-06 mr1297 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 2.74E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 4.52E-06 mr1351 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 5.03E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 5.37E-07 mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 4.27E-06 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 1.64E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 8.65E-06 8.64E-06 mr1501 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 1.06E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 4.57E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 1.86E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 1.76E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 2.33E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 1.02E-08 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 4.54E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 3.30E-06 7.33E-11 mr1776 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 8.23E-06 8.23E-06 mr1776 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316990859 NA 5.61E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251