\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316974733:

Variant ID: vg0316974733 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16974733
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGCGTGTAAATTGCGAGACGAATCTTTTAAACCTAACTAATTGCTCCATAATTTGAAAGTGTGCTACAATAAATATTTACTAATGATAGATTAATTAT[G/A]
CTTAATAAATTTGTCTAACGGTTCTCTGGTGGCATCTGTGCCTTTGTTTTATTATTATATTACGTTTAATGCTTTAAATGTGTATTCGTGTATATCCGAT

Reverse complement sequence

ATCGGATATACACGAATACACATTTAAAGCATTAAACGTAATATAATAATAAAACAAAGGCACAGATGCCACCAGAGAACCGTTAGACAAATTTATTAAG[C/T]
ATAATTAATCTATCATTAGTAAATATTTATTGTAGCACACTTTCAAATTATGGAGCAATTAGTTAGGTTTAAAAGATTCGTCTCGCAATTTACACGCAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 37.20% 0.08% 0.00% NA
All Indica  2759 48.80% 51.10% 0.07% 0.00% NA
All Japonica  1512 96.20% 3.80% 0.07% 0.00% NA
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 42.20% 57.60% 0.17% 0.00% NA
Indica II  465 76.80% 23.00% 0.22% 0.00% NA
Indica III  913 40.00% 60.00% 0.00% 0.00% NA
Indica Intermediate  786 47.60% 52.40% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 88.70% 11.10% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316974733 G -> A LOC_Os03g29760.1 downstream_gene_variant ; 3961.0bp to feature; MODIFIER silent_mutation Average:94.622; most accessible tissue: Zhenshan97 young leaf, score: 98.182 N N N N
vg0316974733 G -> A LOC_Os03g29770.1 downstream_gene_variant ; 41.0bp to feature; MODIFIER silent_mutation Average:94.622; most accessible tissue: Zhenshan97 young leaf, score: 98.182 N N N N
vg0316974733 G -> A LOC_Os03g29760.3 downstream_gene_variant ; 3961.0bp to feature; MODIFIER silent_mutation Average:94.622; most accessible tissue: Zhenshan97 young leaf, score: 98.182 N N N N
vg0316974733 G -> A LOC_Os03g29760.2 downstream_gene_variant ; 3961.0bp to feature; MODIFIER silent_mutation Average:94.622; most accessible tissue: Zhenshan97 young leaf, score: 98.182 N N N N
vg0316974733 G -> A LOC_Os03g29760-LOC_Os03g29770 intergenic_region ; MODIFIER silent_mutation Average:94.622; most accessible tissue: Zhenshan97 young leaf, score: 98.182 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0316974733 G A -0.01 -0.02 0.0 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316974733 NA 7.60E-12 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 1.88E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 1.13E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 1.25E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 9.73E-10 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 2.10E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 6.45E-08 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 1.13E-13 mr1307 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 1.91E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 2.72E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 9.64E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 8.88E-07 mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 1.45E-06 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 4.57E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 7.05E-06 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 3.43E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 4.13E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 3.56E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 4.96E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 2.61E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 2.84E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 6.90E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 1.06E-10 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 3.80E-08 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 3.33E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 2.04E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 6.04E-10 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316974733 NA 1.64E-06 mr1984 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251