Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316957285:

Variant ID: vg0316957285 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16957285
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTGGAGTAGTCTAAACCCATCCACTTCTTTAGTTTATTTTGTGACAGCGTTCCACCTAGTTCTGCTCCTATTTTAGATAGAGCTGGAATTATTTGGTT[G/A]
GACTTTAGCTTCAGAAGAGGTGGTAGAGCTAGAACTAGAACTATGCCAAATAGATCCTGACCCAAACAGGCCCTTCCTATCCAGCAGCTTATAAAAAGAA

Reverse complement sequence

TTCTTTTTATAAGCTGCTGGATAGGAAGGGCCTGTTTGGGTCAGGATCTATTTGGCATAGTTCTAGTTCTAGCTCTACCACCTCTTCTGAAGCTAAAGTC[C/T]
AACCAAATAATTCCAGCTCTATCTAAAATAGGAGCAGAACTAGGTGGAACGCTGTCACAAAATAAACTAAAGAAGTGGATGGGTTTAGACTACTCCACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.90% 34.10% 0.00% 0.00% NA
All Indica  2759 56.90% 43.10% 0.00% 0.00% NA
All Japonica  1512 95.90% 4.10% 0.00% 0.00% NA
Aus  269 7.10% 92.90% 0.00% 0.00% NA
Indica I  595 49.90% 50.10% 0.00% 0.00% NA
Indica II  465 81.30% 18.70% 0.00% 0.00% NA
Indica III  913 50.40% 49.60% 0.00% 0.00% NA
Indica Intermediate  786 55.30% 44.70% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 88.50% 11.50% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316957285 G -> A LOC_Os03g29750.1 downstream_gene_variant ; 2553.0bp to feature; MODIFIER silent_mutation Average:92.11; most accessible tissue: Minghui63 root, score: 98.844 N N N N
vg0316957285 G -> A LOC_Os03g29750.2 downstream_gene_variant ; 2553.0bp to feature; MODIFIER silent_mutation Average:92.11; most accessible tissue: Minghui63 root, score: 98.844 N N N N
vg0316957285 G -> A LOC_Os03g29750-LOC_Os03g29760 intergenic_region ; MODIFIER silent_mutation Average:92.11; most accessible tissue: Minghui63 root, score: 98.844 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0316957285 G A -0.02 -0.09 -0.04 -0.02 -0.06 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316957285 NA 1.98E-15 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316957285 NA 5.24E-09 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316957285 NA 1.94E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316957285 NA 2.03E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316957285 NA 5.44E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316957285 NA 4.86E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316957285 NA 1.38E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316957285 NA 9.44E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316957285 NA 2.49E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316957285 NA 4.73E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316957285 NA 1.93E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316957285 NA 1.59E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316957285 NA 1.64E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316957285 NA 2.09E-09 mr1743_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251