\
| Variant ID: vg0316691399 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16691399 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, A: 0.11, others allele: 0.00, population size: 104. )
TATTCAAAAACTTTTGTGAAATGTGTAAAACTATATATATACATAAAAGTATATTTAACAATAAATTAAATGATAGAAAAAGAATTAATAATTACTTAAA[T/A]
TTTTTGAATAAGACGAACGGTCAAACATTTTTTAAAAAGTCAACGGCGTCAAACATTTTAGGATGGAGGGAGTATTTCTTATTCTAGGTTTCTATGAGAG
CTCTCATAGAAACCTAGAATAAGAAATACTCCCTCCATCCTAAAATGTTTGACGCCGTTGACTTTTTAAAAAATGTTTGACCGTTCGTCTTATTCAAAAA[A/T]
TTTAAGTAATTATTAATTCTTTTTCTATCATTTAATTTATTGTTAAATATACTTTTATGTATATATATAGTTTTACACATTTCACAAAAGTTTTTGAATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.60% | 39.40% | 5.21% | 5.73% | NA |
| All Indica | 2759 | 35.70% | 55.60% | 1.99% | 6.74% | NA |
| All Japonica | 1512 | 74.90% | 8.30% | 11.90% | 4.89% | NA |
| Aus | 269 | 29.40% | 69.50% | 1.12% | 0.00% | NA |
| Indica I | 595 | 10.90% | 82.90% | 2.02% | 4.20% | NA |
| Indica II | 465 | 67.10% | 15.30% | 4.52% | 13.12% | NA |
| Indica III | 913 | 37.70% | 58.50% | 0.55% | 3.29% | NA |
| Indica Intermediate | 786 | 33.50% | 55.50% | 2.16% | 8.91% | NA |
| Temperate Japonica | 767 | 70.10% | 0.30% | 20.73% | 8.87% | NA |
| Tropical Japonica | 504 | 74.40% | 23.60% | 1.39% | 0.60% | NA |
| Japonica Intermediate | 241 | 90.90% | 2.10% | 5.81% | 1.24% | NA |
| VI/Aromatic | 96 | 95.80% | 1.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 64.40% | 17.80% | 7.78% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316691399 | T -> A | LOC_Os03g29330.1 | upstream_gene_variant ; 539.0bp to feature; MODIFIER | silent_mutation | Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0316691399 | T -> A | LOC_Os03g29340.1 | upstream_gene_variant ; 1118.0bp to feature; MODIFIER | silent_mutation | Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0316691399 | T -> A | LOC_Os03g29340.2 | upstream_gene_variant ; 1120.0bp to feature; MODIFIER | silent_mutation | Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0316691399 | T -> A | LOC_Os03g29350.1 | downstream_gene_variant ; 4523.0bp to feature; MODIFIER | silent_mutation | Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0316691399 | T -> A | LOC_Os03g29350.2 | downstream_gene_variant ; 4523.0bp to feature; MODIFIER | silent_mutation | Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0316691399 | T -> A | LOC_Os03g29350.4 | downstream_gene_variant ; 4523.0bp to feature; MODIFIER | silent_mutation | Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0316691399 | T -> A | LOC_Os03g29330-LOC_Os03g29340 | intergenic_region ; MODIFIER | silent_mutation | Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0316691399 | T -> DEL | N | N | silent_mutation | Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316691399 | NA | 7.01E-06 | mr1068_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316691399 | 1.71E-06 | 2.32E-09 | mr1090_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316691399 | NA | 4.40E-06 | mr1094_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316691399 | NA | 6.30E-07 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |