\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316691399:

Variant ID: vg0316691399 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16691399
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, A: 0.11, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TATTCAAAAACTTTTGTGAAATGTGTAAAACTATATATATACATAAAAGTATATTTAACAATAAATTAAATGATAGAAAAAGAATTAATAATTACTTAAA[T/A]
TTTTTGAATAAGACGAACGGTCAAACATTTTTTAAAAAGTCAACGGCGTCAAACATTTTAGGATGGAGGGAGTATTTCTTATTCTAGGTTTCTATGAGAG

Reverse complement sequence

CTCTCATAGAAACCTAGAATAAGAAATACTCCCTCCATCCTAAAATGTTTGACGCCGTTGACTTTTTAAAAAATGTTTGACCGTTCGTCTTATTCAAAAA[A/T]
TTTAAGTAATTATTAATTCTTTTTCTATCATTTAATTTATTGTTAAATATACTTTTATGTATATATATAGTTTTACACATTTCACAAAAGTTTTTGAATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.60% 39.40% 5.21% 5.73% NA
All Indica  2759 35.70% 55.60% 1.99% 6.74% NA
All Japonica  1512 74.90% 8.30% 11.90% 4.89% NA
Aus  269 29.40% 69.50% 1.12% 0.00% NA
Indica I  595 10.90% 82.90% 2.02% 4.20% NA
Indica II  465 67.10% 15.30% 4.52% 13.12% NA
Indica III  913 37.70% 58.50% 0.55% 3.29% NA
Indica Intermediate  786 33.50% 55.50% 2.16% 8.91% NA
Temperate Japonica  767 70.10% 0.30% 20.73% 8.87% NA
Tropical Japonica  504 74.40% 23.60% 1.39% 0.60% NA
Japonica Intermediate  241 90.90% 2.10% 5.81% 1.24% NA
VI/Aromatic  96 95.80% 1.00% 1.04% 2.08% NA
Intermediate  90 64.40% 17.80% 7.78% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316691399 T -> A LOC_Os03g29330.1 upstream_gene_variant ; 539.0bp to feature; MODIFIER silent_mutation Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0316691399 T -> A LOC_Os03g29340.1 upstream_gene_variant ; 1118.0bp to feature; MODIFIER silent_mutation Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0316691399 T -> A LOC_Os03g29340.2 upstream_gene_variant ; 1120.0bp to feature; MODIFIER silent_mutation Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0316691399 T -> A LOC_Os03g29350.1 downstream_gene_variant ; 4523.0bp to feature; MODIFIER silent_mutation Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0316691399 T -> A LOC_Os03g29350.2 downstream_gene_variant ; 4523.0bp to feature; MODIFIER silent_mutation Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0316691399 T -> A LOC_Os03g29350.4 downstream_gene_variant ; 4523.0bp to feature; MODIFIER silent_mutation Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0316691399 T -> A LOC_Os03g29330-LOC_Os03g29340 intergenic_region ; MODIFIER silent_mutation Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0316691399 T -> DEL N N silent_mutation Average:32.256; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316691399 NA 7.01E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316691399 1.71E-06 2.32E-09 mr1090_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316691399 NA 4.40E-06 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316691399 NA 6.30E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251