\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316689752:

Variant ID: vg0316689752 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16689752
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAAATTTACTCTTTGTTATGATTGCAACTACCACGTCAATACCACGTAGAACGATGACCTAGTTAAACCAGCCACGCAGACGCCACATCAACCGAAAC[T/C]
ACCATCTAATCCGTCTTGGGACCAAGTTTGCACTGGTTTTAGAAGTTTTTTTTTGCGGAAAAGAAAACATATATTACTCAGGATCAATGAATCCACAGAC

Reverse complement sequence

GTCTGTGGATTCATTGATCCTGAGTAATATATGTTTTCTTTTCCGCAAAAAAAAACTTCTAAAACCAGTGCAAACTTGGTCCCAAGACGGATTAGATGGT[A/G]
GTTTCGGTTGATGTGGCGTCTGCGTGGCTGGTTTAACTAGGTCATCGTTCTACGTGGTATTGACGTGGTAGTTGCAATCATAACAAAGAGTAAATTTACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 42.40% 0.04% 0.02% NA
All Indica  2759 39.70% 60.20% 0.07% 0.04% NA
All Japonica  1512 91.60% 8.40% 0.00% 0.00% NA
Aus  269 28.60% 71.40% 0.00% 0.00% NA
Indica I  595 10.80% 89.10% 0.17% 0.00% NA
Indica II  465 83.40% 16.60% 0.00% 0.00% NA
Indica III  913 36.40% 63.50% 0.11% 0.00% NA
Indica Intermediate  786 39.60% 60.30% 0.00% 0.13% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 76.20% 23.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316689752 T -> C LOC_Os03g29310.1 upstream_gene_variant ; 4866.0bp to feature; MODIFIER silent_mutation Average:40.083; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N
vg0316689752 T -> C LOC_Os03g29340.1 upstream_gene_variant ; 2765.0bp to feature; MODIFIER silent_mutation Average:40.083; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N
vg0316689752 T -> C LOC_Os03g29340.2 upstream_gene_variant ; 2767.0bp to feature; MODIFIER silent_mutation Average:40.083; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N
vg0316689752 T -> C LOC_Os03g29330.1 intron_variant ; MODIFIER silent_mutation Average:40.083; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N
vg0316689752 T -> DEL N N silent_mutation Average:40.083; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316689752 3.25E-11 3.31E-16 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316689752 2.04E-09 6.19E-45 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316689752 NA 8.45E-14 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0316689752 NA 1.84E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 5.28E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 1.98E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 2.09E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 9.06E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 2.92E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 1.93E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 3.26E-06 6.14E-07 mr1084_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 1.19E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 6.74E-06 6.74E-06 mr1105_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 4.19E-06 2.15E-07 mr1204_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 3.91E-06 mr1205_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 5.81E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 9.48E-07 mr1239_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 2.00E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 5.93E-08 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 6.32E-07 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 8.28E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 1.27E-06 NA mr1566_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 2.28E-07 mr1567_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 6.57E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 8.08E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 4.60E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 9.49E-07 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 2.06E-09 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 3.81E-07 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 6.41E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 6.75E-07 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316689752 NA 2.27E-07 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251