\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316685104:

Variant ID: vg0316685104 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16685104
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTTAGATGCTTCCTTAATAAATATCGGCTGCGTTCTCCGCATCTCATACATCCATGACAACCGATCCATCTAATTATATAAAGGCAAAAATAGACCG[C/T]
AGGTATTTCATACAAAAGTTTAAATGCATTTGTCTCCCAAAAAAAATTACAACAATACATGTAACTAGTATGTACAAGTGATTACATGCAAAATTTGCCC

Reverse complement sequence

GGGCAAATTTTGCATGTAATCACTTGTACATACTAGTTACATGTATTGTTGTAATTTTTTTTGGGAGACAAATGCATTTAAACTTTTGTATGAAATACCT[G/A]
CGGTCTATTTTTGCCTTTATATAATTAGATGGATCGGTTGTCATGGATGTATGAGATGCGGAGAACGCAGCCGATATTTATTAAGGAAGCATCTAAATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 1.90% 9.59% 21.05% NA
All Indica  2759 46.20% 3.30% 15.08% 35.48% NA
All Japonica  1512 98.80% 0.00% 0.99% 0.20% NA
Aus  269 94.80% 0.40% 4.46% 0.37% NA
Indica I  595 16.00% 8.10% 30.08% 45.88% NA
Indica II  465 85.40% 1.50% 3.66% 9.46% NA
Indica III  913 44.70% 1.50% 10.51% 43.26% NA
Indica Intermediate  786 47.60% 2.70% 15.78% 33.97% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 0.00% 1.98% 0.60% NA
Japonica Intermediate  241 97.90% 0.00% 2.07% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 3.12% 1.04% NA
Intermediate  90 78.90% 1.10% 7.78% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316685104 C -> T LOC_Os03g29310.1 upstream_gene_variant ; 218.0bp to feature; MODIFIER silent_mutation Average:22.231; most accessible tissue: Minghui63 flag leaf, score: 49.097 N N N N
vg0316685104 C -> T LOC_Os03g29330.1 downstream_gene_variant ; 4533.0bp to feature; MODIFIER silent_mutation Average:22.231; most accessible tissue: Minghui63 flag leaf, score: 49.097 N N N N
vg0316685104 C -> T LOC_Os03g29310-LOC_Os03g29330 intergenic_region ; MODIFIER silent_mutation Average:22.231; most accessible tissue: Minghui63 flag leaf, score: 49.097 N N N N
vg0316685104 C -> DEL N N silent_mutation Average:22.231; most accessible tissue: Minghui63 flag leaf, score: 49.097 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316685104 NA 3.25E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 NA 7.47E-06 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 NA 4.68E-06 mr1314 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 9.50E-06 9.50E-06 mr1393 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 NA 8.12E-06 mr1432 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 NA 3.27E-06 mr1434 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 NA 1.63E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 7.73E-06 7.73E-06 mr1445 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 NA 2.32E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 NA 2.41E-06 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 2.17E-06 2.17E-06 mr1485 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 NA 1.48E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 2.27E-06 2.27E-06 mr1545 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 NA 1.51E-06 mr1549 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 NA 7.58E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 NA 4.47E-06 mr1633 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 NA 2.15E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 8.21E-06 6.59E-08 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 6.82E-06 2.67E-07 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 4.23E-07 4.22E-07 mr1681 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 NA 9.62E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104 NA 4.58E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251