Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316685104:

Variant ID: vg0316685104 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16685104
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATTTAGATGCTTCCTTAATAAATATCGGCTGCGTTCTCCGCATCTCATACATCCATGACAACCGATCCATCTAATTATATAAAGGCAAAAATAGACCG[C/T]
AGGTATTTCATACAAAAGTTTAAATGCATTTGTCTCCCAAAAAAAATTACAACAATACATGTAACTAGTATGTACAAGTGATTACATGCAAAATTTGCCC

Reverse complement sequence

GGGCAAATTTTGCATGTAATCACTTGTACATACTAGTTACATGTATTGTTGTAATTTTTTTTGGGAGACAAATGCATTTAAACTTTTGTATGAAATACCT[G/A]
CGGTCTATTTTTGCCTTTATATAATTAGATGGATCGGTTGTCATGGATGTATGAGATGCGGAGAACGCAGCCGATATTTATTAAGGAAGCATCTAAATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.40%	1.90%	9.59%	21.05%	NA
All Indica	2759	46.20%	3.30%	15.08%	35.48%	NA
All Japonica	1512	98.80%	0.00%	0.99%	0.20%	NA
Aus	269	94.80%	0.40%	4.46%	0.37%	NA
Indica I	595	16.00%	8.10%	30.08%	45.88%	NA
Indica II	465	85.40%	1.50%	3.66%	9.46%	NA
Indica III	913	44.70%	1.50%	10.51%	43.26%	NA
Indica Intermediate	786	47.60%	2.70%	15.78%	33.97%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	97.40%	0.00%	1.98%	0.60%	NA
Japonica Intermediate	241	97.90%	0.00%	2.07%	0.00%	NA
VI/Aromatic	96	95.80%	0.00%	3.12%	1.04%	NA
Intermediate	90	78.90%	1.10%	7.78%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316685104	C -> T	LOC_Os03g29310.1	upstream_gene_variant ; 218.0bp to feature; MODIFIER	silent_mutation	Average:22.231; most accessible tissue: Minghui63 flag leaf, score: 49.097	N	N	N	N
vg0316685104	C -> T	LOC_Os03g29330.1	downstream_gene_variant ; 4533.0bp to feature; MODIFIER	silent_mutation	Average:22.231; most accessible tissue: Minghui63 flag leaf, score: 49.097	N	N	N	N
vg0316685104	C -> T	LOC_Os03g29310-LOC_Os03g29330	intergenic_region ; MODIFIER	silent_mutation	Average:22.231; most accessible tissue: Minghui63 flag leaf, score: 49.097	N	N	N	N
vg0316685104	C -> DEL	N	N	silent_mutation	Average:22.231; most accessible tissue: Minghui63 flag leaf, score: 49.097	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316685104	NA	3.25E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	NA	7.47E-06	mr1286	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	NA	4.68E-06	mr1314	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	9.50E-06	9.50E-06	mr1393	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	NA	8.12E-06	mr1432	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	NA	3.27E-06	mr1434	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	NA	1.63E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	7.73E-06	7.73E-06	mr1445	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	NA	2.32E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	NA	2.41E-06	mr1485	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	2.17E-06	2.17E-06	mr1485	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	NA	1.48E-07	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	2.27E-06	2.27E-06	mr1545	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	NA	1.51E-06	mr1549	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	NA	7.58E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	NA	4.47E-06	mr1633	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	NA	2.15E-06	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	8.21E-06	6.59E-08	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	6.82E-06	2.67E-07	mr1665	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	4.23E-07	4.22E-07	mr1681	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	NA	9.62E-06	mr1820	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316685104	NA	4.58E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251