\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316611015:

Variant ID: vg0316611015 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16611015
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGCAATGATCAAAGCTGGATTCGATAAAGGGGGAGTGTTATGAAACAACAGGGTGATCTCATCCATATAAAAGGATGGATCACAACCGAAGGCAACCG[C/T]
GCCTCTTCCCAACCATCGCGTCTCCGGTTGCCACCCCTTCCCCATCTATATATTGTACCGTATTGATCAATAAAAGATTCCGCTCATTCATTTCCTACAT

Reverse complement sequence

ATGTAGGAAATGAATGAGCGGAATCTTTTATTGATCAATACGGTACAATATATAGATGGGGAAGGGGTGGCAACCGGAGACGCGATGGTTGGGAAGAGGC[G/A]
CGGTTGCCTTCGGTTGTGATCCATCCTTTTATATGGATGAGATCACCCTGTTGTTTCATAACACTCCCCCTTTATCGAATCCAGCTTTGATCATTGCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 12.90% 11.17% 0.00% NA
All Indica  2759 59.70% 21.40% 18.85% 0.00% NA
All Japonica  1512 99.60% 0.30% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 71.10% 7.20% 21.68% 0.00% NA
Indica II  465 49.50% 27.10% 23.44% 0.00% NA
Indica III  913 55.90% 29.80% 14.35% 0.00% NA
Indica Intermediate  786 61.70% 19.10% 19.21% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 3.10% 2.08% 0.00% NA
Intermediate  90 82.20% 13.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316611015 C -> T LOC_Os03g29206.1 downstream_gene_variant ; 4277.0bp to feature; MODIFIER silent_mutation Average:32.679; most accessible tissue: Zhenshan97 young leaf, score: 47.986 N N N N
vg0316611015 C -> T LOC_Os03g29212.1 downstream_gene_variant ; 674.0bp to feature; MODIFIER silent_mutation Average:32.679; most accessible tissue: Zhenshan97 young leaf, score: 47.986 N N N N
vg0316611015 C -> T LOC_Os03g29220.1 downstream_gene_variant ; 3938.0bp to feature; MODIFIER silent_mutation Average:32.679; most accessible tissue: Zhenshan97 young leaf, score: 47.986 N N N N
vg0316611015 C -> T LOC_Os03g29212-LOC_Os03g29220 intergenic_region ; MODIFIER silent_mutation Average:32.679; most accessible tissue: Zhenshan97 young leaf, score: 47.986 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316611015 NA 2.71E-08 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 3.83E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 2.06E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 2.01E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 2.35E-06 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 2.66E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 2.78E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 5.43E-06 4.78E-06 mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 3.51E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 9.06E-06 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 3.92E-06 mr1434 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 8.94E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 8.91E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 9.78E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 5.05E-07 mr1656 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 1.09E-07 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 1.14E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 1.14E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 6.07E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 3.98E-06 3.96E-06 mr1814 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 5.93E-06 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316611015 NA 2.17E-06 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251