\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316608593:

Variant ID: vg0316608593 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16608593
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AATAACCTACCAGATGCATTTACCAATTATAAAGGTGTGACTAAATCTTTCATTCCCGCTAAGAATGCGCCAGAAAGAGTGGAGGTACCAAATAAAACCA[C/T]
TCAACTTCCACTCACTAAAAAGAGAGGAAGAAGTATGGCCACTCAGTGAGAAACAATTGCTTATAAGCAAAGAAAGACGGTAAATGCAAACCAACCTTTT

Reverse complement sequence

AAAAGGTTGGTTTGCATTTACCGTCTTTCTTTGCTTATAAGCAATTGTTTCTCACTGAGTGGCCATACTTCTTCCTCTCTTTTTAGTGAGTGGAAGTTGA[G/A]
TGGTTTTATTTGGTACCTCCACTCTTTCTGGCGCATTCTTAGCGGGAATGAAAGATTTAGTCACACCTTTATAATTGGTAAATGCATCTGGTAGGTTATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 40.70% 0.06% 0.00% NA
All Indica  2759 31.90% 68.00% 0.07% 0.00% NA
All Japonica  1512 99.20% 0.70% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 49.40% 50.40% 0.17% 0.00% NA
Indica II  465 10.10% 89.90% 0.00% 0.00% NA
Indica III  913 29.90% 70.10% 0.00% 0.00% NA
Indica Intermediate  786 33.80% 66.00% 0.13% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.20% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316608593 C -> T LOC_Os03g29200.1 downstream_gene_variant ; 4476.0bp to feature; MODIFIER silent_mutation Average:37.427; most accessible tissue: Minghui63 root, score: 51.763 N N N N
vg0316608593 C -> T LOC_Os03g29206.1 downstream_gene_variant ; 1855.0bp to feature; MODIFIER silent_mutation Average:37.427; most accessible tissue: Minghui63 root, score: 51.763 N N N N
vg0316608593 C -> T LOC_Os03g29212.1 intron_variant ; MODIFIER silent_mutation Average:37.427; most accessible tissue: Minghui63 root, score: 51.763 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316608593 NA 6.16E-06 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 1.25E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 8.10E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 5.30E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 2.66E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 7.46E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 1.47E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 2.52E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 9.16E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 3.25E-06 5.68E-06 mr1433 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 3.59E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 4.75E-06 mr1434 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 2.55E-06 mr1434 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 8.15E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 3.75E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 1.17E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 4.84E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 2.96E-07 mr1656 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 7.45E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 5.72E-07 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 1.03E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 2.42E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 1.74E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 2.22E-07 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316608593 NA 8.17E-06 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251