Search for Variation information by Variation ID:
Detailed information for vg0316605932:
| Variant ID: vg0316605932 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16605932 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.06, others allele: 0.00, population size: 268. )
Flanking Sequence (100 bp) in Reference Genome:
TTCTTTTGAGACTCTACATTCACAAGGATCTCAAACATGAATACATGTTAGAGACGAGCCCTCTCAACCTTTGGAAAGCTCTAAAAGAGCGTTATGATCA[G/T]
CAAAAGGAACTCATTTGGCCTGAGGCTAATTATGAGTGGGTTCATTTATGCCTACAGGACTTTAAAACTATGGCAGAATACAACCATGCTGTTCATAACA
Reverse complement sequence
TGTTATGAACAGCATGGTTGTATTCTGCCATAGTTTTAAAGTCCTGTAGGCATAAATGAACCCACTCATAATTAGCCTCAGGCCAAATGAGTTCCTTTTG[C/A]
TGATCATAACGCTCTTTTAGAGCTTTCCAAAGGTTGAGAGGGCTCGTCTCTAACATGTATTCATGTTTGAGATCCTTGTGAATGTAGAGTCTCAAAAGAA
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.30% | 14.20% | 1.52% | 0.00% | NA |
| All Indica | 2759 | 89.10% | 9.30% | 1.59% | 0.00% | NA |
| All Japonica | 1512 | 83.50% | 15.90% | 0.60% | 0.00% | NA |
| Aus | 269 | 33.10% | 59.90% | 7.06% | 0.00% | NA |
| Indica I | 595 | 94.30% | 5.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.90% | 14.60% | 3.50% | 0.00% | NA |
| Indica Intermediate | 786 | 87.80% | 11.20% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 54.80% | 43.50% | 1.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316605932 | G -> T | LOC_Os03g29206.1 | missense_variant ; p.Gln89His; MODERATE | nonsynonymous_codon ; Q89H | Average:33.837; most accessible tissue: Minghui63 flag leaf, score: 52.88 | probably damaging  |
2.477 |
TOLERATED | 0.18 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316605932 | NA | 3.06E-12 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0316605932 | NA | 4.05E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316605932 | 7.00E-07 | 2.52E-07 | mr1113 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316605932 | 3.91E-06 | 2.92E-06 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316605932 | NA | 7.53E-07 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316605932 | 9.46E-07 | 1.09E-06 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316605932 | NA | 8.84E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316605932 | NA | 4.40E-06 | mr1638_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316605932 | NA | 5.73E-06 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |