Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0316604658:

Variant ID: vg0316604658 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16604658
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

AAGAGATCATGAGTTCAAGGATTGGCAAAAATAAGAGAAAATATTTTATTCTCATTTTCATATTGGTTTCATATGGTTGTGGTACAATTTAATGTCTCTA[G/A]
AAAATGCCTCTACCACCTTATAGACATTTTATAAAATGCCTCTTCGTTTGTAGAGACAATTCACCATAAGGCACTTATTAGACATTTTTTAAAATGCCTC

Reverse complement sequence

GAGGCATTTTAAAAAATGTCTAATAAGTGCCTTATGGTGAATTGTCTCTACAAACGAAGAGGCATTTTATAAAATGTCTATAAGGTGGTAGAGGCATTTT[C/T]
TAGAGACATTAAATTGTACCACAACCATATGAAACCAATATGAAAATGAGAATAAAATATTTTCTCTTATTTTTGCCAATCCTTGAACTCATGATCTCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.60%	40.40%	5.63%	3.43%	NA
All Indica	2759	31.20%	67.50%	0.69%	0.62%	NA
All Japonica	1512	83.10%	0.80%	13.82%	2.31%	NA
Aus	269	46.10%	0.40%	12.64%	40.89%	NA
Indica I	595	49.90%	49.90%	0.17%	0.00%	NA
Indica II	465	10.30%	89.20%	0.43%	0.00%	NA
Indica III	913	29.00%	69.40%	0.44%	1.10%	NA
Indica Intermediate	786	31.80%	65.80%	1.53%	0.89%	NA
Temperate Japonica	767	99.30%	0.40%	0.26%	0.00%	NA
Tropical Japonica	504	54.00%	1.40%	38.10%	6.55%	NA
Japonica Intermediate	241	92.10%	0.80%	6.22%	0.83%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	65.60%	30.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316604658	G -> A	LOC_Os03g29194.1	upstream_gene_variant ; 2792.0bp to feature; MODIFIER	silent_mutation	Average:21.96; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0316604658	G -> A	LOC_Os03g29206.1	upstream_gene_variant ; 1008.0bp to feature; MODIFIER	silent_mutation	Average:21.96; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0316604658	G -> A	LOC_Os03g29212.1	upstream_gene_variant ; 2546.0bp to feature; MODIFIER	silent_mutation	Average:21.96; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0316604658	G -> A	LOC_Os03g29200.1	downstream_gene_variant ; 541.0bp to feature; MODIFIER	silent_mutation	Average:21.96; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0316604658	G -> A	LOC_Os03g29200-LOC_Os03g29206	intergenic_region ; MODIFIER	silent_mutation	Average:21.96; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0316604658	G -> DEL	N	N	silent_mutation	Average:21.96; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316604658	9.32E-07	1.79E-08	mr1576_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316604658	1.91E-06	4.46E-07	mr1576_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251