| Variant ID: vg0316595932 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16595932 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCATTATTATGTGCAAACCAAAACCATATGTAAGTATGAGTCCGGATTGGTAATTGGGTATCTTGAATCATGTTGTGAGTAATAGATCTTAGAGCAGTCA[G/C]
AAATCTATCTATATTAACTTATTAAAGAAATAGAAAAAGGAGCCTCCACGTTCGCTCTCACGGTCTAAAAATTCTTATATTAATCGGAGAAAAAGAAAAC
GTTTTCTTTTTCTCCGATTAATATAAGAATTTTTAGACCGTGAGAGCGAACGTGGAGGCTCCTTTTTCTATTTCTTTAATAAGTTAATATAGATAGATTT[C/G]
TGACTGCTCTAAGATCTATTACTCACAACATGATTCAAGATACCCAATTACCAATCCGGACTCATACTTACATATGGTTTTGGTTTGCACATAATAATGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.00% | 7.90% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 97.10% | 2.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 85.60% | 14.00% | 0.40% | 0.00% | NA |
| Aus | 269 | 74.30% | 25.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 7.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 93.90% | 5.90% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.00% | 47.30% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316595932 | G -> C | LOC_Os03g29190.1 | 3_prime_UTR_variant ; 288.0bp to feature; MODIFIER | silent_mutation | Average:59.336; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| vg0316595932 | G -> C | LOC_Os03g29190.2 | 3_prime_UTR_variant ; 288.0bp to feature; MODIFIER | silent_mutation | Average:59.336; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| vg0316595932 | G -> C | LOC_Os03g29194.1 | downstream_gene_variant ; 3667.0bp to feature; MODIFIER | silent_mutation | Average:59.336; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316595932 | NA | 8.11E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316595932 | NA | 9.18E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316595932 | NA | 2.91E-07 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316595932 | NA | 2.33E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316595932 | 5.61E-08 | 5.61E-08 | mr1197_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316595932 | NA | 4.43E-07 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316595932 | NA | 2.00E-07 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316595932 | NA | 3.97E-06 | mr1961_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |