Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316586640:

Variant ID: vg0316586640 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16586640
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:

TTATATATTAAAGCCATTATAGTTTTATACAAGTTATCCAAGCAATGCAGATATAGAAACACTGATACAGAAATAACTATATATGTCGGTTGGGAAACCC[T/C]
CATGGGTGCCGGATTTTACAACAGGCACCAGTAGACGACACCTTTGAGGTGGTCTAGGAACCGGCACTATTGAGGTTACAGGAACTTAAAAAAGGTGGCT

Reverse complement sequence

AGCCACCTTTTTTAAGTTCCTGTAACCTCAATAGTGCCGGTTCCTAGACCACCTCAAAGGTGTCGTCTACTGGTGCCTGTTGTAAAATCCGGCACCCATG[A/G]
GGGTTTCCCAACCGACATATATAGTTATTTCTGTATCAGTGTTTCTATATCTGCATTGCTTGGATAACTTGTATAAAACTATAATGGCTTTAATATATAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.30%	24.50%	0.06%	0.13%	NA
All Indica	2759	83.30%	16.50%	0.04%	0.22%	NA
All Japonica	1512	60.40%	39.50%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	57.60%	42.20%	0.17%	0.00%	NA
Indica II	465	94.40%	5.60%	0.00%	0.00%	NA
Indica III	913	91.30%	8.40%	0.00%	0.22%	NA
Indica Intermediate	786	86.80%	12.70%	0.00%	0.51%	NA
Temperate Japonica	767	50.30%	49.50%	0.13%	0.00%	NA
Tropical Japonica	504	73.80%	26.20%	0.00%	0.00%	NA
Japonica Intermediate	241	64.70%	35.30%	0.00%	0.00%	NA
VI/Aromatic	96	16.70%	83.30%	0.00%	0.00%	NA
Intermediate	90	73.30%	25.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316586640	T -> C	LOC_Os03g29184.1	3_prime_UTR_variant ; 54.0bp to feature; MODIFIER	silent_mutation	Average:81.315; most accessible tissue: Minghui63 root, score: 91.296	N	N	N	N
vg0316586640	T -> C	LOC_Os03g29190.1	upstream_gene_variant ; 3547.0bp to feature; MODIFIER	silent_mutation	Average:81.315; most accessible tissue: Minghui63 root, score: 91.296	N	N	N	N
vg0316586640	T -> C	LOC_Os03g29190.2	upstream_gene_variant ; 3547.0bp to feature; MODIFIER	silent_mutation	Average:81.315; most accessible tissue: Minghui63 root, score: 91.296	N	N	N	N
vg0316586640	T -> C	LOC_Os03g29180.1	downstream_gene_variant ; 487.0bp to feature; MODIFIER	silent_mutation	Average:81.315; most accessible tissue: Minghui63 root, score: 91.296	N	N	N	N
vg0316586640	T -> DEL	N	N	silent_mutation	Average:81.315; most accessible tissue: Minghui63 root, score: 91.296	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316586640	NA	2.70E-08	mr1456_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316586640	1.86E-06	1.86E-06	mr1470_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316586640	NA	6.24E-06	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316586640	NA	1.01E-06	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316586640	1.31E-06	1.31E-06	mr1719_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316586640	NA	5.51E-06	mr1726_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316586640	NA	7.55E-06	mr1736_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316586640	NA	3.65E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316586640	5.53E-06	5.53E-06	mr1914_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251