\
| Variant ID: vg0316586640 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16586640 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 127. )
TTATATATTAAAGCCATTATAGTTTTATACAAGTTATCCAAGCAATGCAGATATAGAAACACTGATACAGAAATAACTATATATGTCGGTTGGGAAACCC[T/C]
CATGGGTGCCGGATTTTACAACAGGCACCAGTAGACGACACCTTTGAGGTGGTCTAGGAACCGGCACTATTGAGGTTACAGGAACTTAAAAAAGGTGGCT
AGCCACCTTTTTTAAGTTCCTGTAACCTCAATAGTGCCGGTTCCTAGACCACCTCAAAGGTGTCGTCTACTGGTGCCTGTTGTAAAATCCGGCACCCATG[A/G]
GGGTTTCCCAACCGACATATATAGTTATTTCTGTATCAGTGTTTCTATATCTGCATTGCTTGGATAACTTGTATAAAACTATAATGGCTTTAATATATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.30% | 24.50% | 0.06% | 0.13% | NA |
| All Indica | 2759 | 83.30% | 16.50% | 0.04% | 0.22% | NA |
| All Japonica | 1512 | 60.40% | 39.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 57.60% | 42.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.30% | 8.40% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 86.80% | 12.70% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 50.30% | 49.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 73.80% | 26.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 25.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316586640 | T -> C | LOC_Os03g29184.1 | 3_prime_UTR_variant ; 54.0bp to feature; MODIFIER | silent_mutation | Average:81.315; most accessible tissue: Minghui63 root, score: 91.296 | N | N | N | N |
| vg0316586640 | T -> C | LOC_Os03g29190.1 | upstream_gene_variant ; 3547.0bp to feature; MODIFIER | silent_mutation | Average:81.315; most accessible tissue: Minghui63 root, score: 91.296 | N | N | N | N |
| vg0316586640 | T -> C | LOC_Os03g29190.2 | upstream_gene_variant ; 3547.0bp to feature; MODIFIER | silent_mutation | Average:81.315; most accessible tissue: Minghui63 root, score: 91.296 | N | N | N | N |
| vg0316586640 | T -> C | LOC_Os03g29180.1 | downstream_gene_variant ; 487.0bp to feature; MODIFIER | silent_mutation | Average:81.315; most accessible tissue: Minghui63 root, score: 91.296 | N | N | N | N |
| vg0316586640 | T -> DEL | N | N | silent_mutation | Average:81.315; most accessible tissue: Minghui63 root, score: 91.296 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316586640 | NA | 2.70E-08 | mr1456_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316586640 | 1.86E-06 | 1.86E-06 | mr1470_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316586640 | NA | 6.24E-06 | mr1511_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316586640 | NA | 1.01E-06 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316586640 | 1.31E-06 | 1.31E-06 | mr1719_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316586640 | NA | 5.51E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316586640 | NA | 7.55E-06 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316586640 | NA | 3.65E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316586640 | 5.53E-06 | 5.53E-06 | mr1914_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |