Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0316570538:

Variant ID: vg0316570538 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16570538
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCGGGAAAAGGCGGCAATAAGGTTTTTGGAAAGCGCTTTGCGCAACTGCTCCCTGTTCGACCACAACGGCTCGTCTTCCTCTTCGCTCGCGTGCTGCA[C/T]
GTCGTCGTCAATGCCCGCAACTGCGAGTCCTTCATGCATGTTGTGAATATTCGATTTGTTCATGCTTTACTATCTAGTTTACATGTGTAGATCTTATAAT

Reverse complement sequence

ATTATAAGATCTACACATGTAAACTAGATAGTAAAGCATGAACAAATCGAATATTCACAACATGCATGAAGGACTCGCAGTTGCGGGCATTGACGACGAC[G/A]
TGCAGCACGCGAGCGAAGAGGAAGACGAGCCGTTGTGGTCGAACAGGGAGCAGTTGCGCAAAGCGCTTTCCAAAAACCTTATTGCCGCCTTTTCCCGATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 10.70% 0.02% 0.00% NA
All Indica  2759 94.30% 5.70% 0.04% 0.00% NA
All Japonica  1512 78.50% 21.50% 0.00% 0.00% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 97.60% 2.20% 0.17% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 88.90% 11.10% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 5.10% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 39.50% 60.50% 0.00% 0.00% NA
Japonica Intermediate  241 92.10% 7.90% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316570538 C -> T LOC_Os03g29170.1 upstream_gene_variant ; 1406.0bp to feature; MODIFIER silent_mutation Average:59.943; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg0316570538 C -> T LOC_Os03g29170.2 upstream_gene_variant ; 1427.0bp to feature; MODIFIER silent_mutation Average:59.943; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg0316570538 C -> T LOC_Os03g29150-LOC_Os03g29170 intergenic_region ; MODIFIER silent_mutation Average:59.943; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316570538 NA 2.52E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538 NA 3.65E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538 NA 9.46E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538 NA 2.42E-07 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538 NA 6.20E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538 NA 2.80E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538 NA 2.58E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538 NA 6.76E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538 NA 2.80E-07 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538 NA 2.21E-06 mr1693_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538 NA 5.67E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538 NA 1.18E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538 NA 7.65E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538 NA 6.79E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251