Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316570538:

Variant ID: vg0316570538 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16570538
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATCGGGAAAAGGCGGCAATAAGGTTTTTGGAAAGCGCTTTGCGCAACTGCTCCCTGTTCGACCACAACGGCTCGTCTTCCTCTTCGCTCGCGTGCTGCA[C/T]
GTCGTCGTCAATGCCCGCAACTGCGAGTCCTTCATGCATGTTGTGAATATTCGATTTGTTCATGCTTTACTATCTAGTTTACATGTGTAGATCTTATAAT

Reverse complement sequence

ATTATAAGATCTACACATGTAAACTAGATAGTAAAGCATGAACAAATCGAATATTCACAACATGCATGAAGGACTCGCAGTTGCGGGCATTGACGACGAC[G/A]
TGCAGCACGCGAGCGAAGAGGAAGACGAGCCGTTGTGGTCGAACAGGGAGCAGTTGCGCAAAGCGCTTTCCAAAAACCTTATTGCCGCCTTTTCCCGATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.30%	10.70%	0.02%	0.00%	NA
All Indica	2759	94.30%	5.70%	0.04%	0.00%	NA
All Japonica	1512	78.50%	21.50%	0.00%	0.00%	NA
Aus	269	96.70%	3.30%	0.00%	0.00%	NA
Indica I	595	97.60%	2.20%	0.17%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	88.90%	11.10%	0.00%	0.00%	NA
Indica Intermediate	786	94.90%	5.10%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	39.50%	60.50%	0.00%	0.00%	NA
Japonica Intermediate	241	92.10%	7.90%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316570538	C -> T	LOC_Os03g29170.1	upstream_gene_variant ; 1406.0bp to feature; MODIFIER	silent_mutation	Average:59.943; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N
vg0316570538	C -> T	LOC_Os03g29170.2	upstream_gene_variant ; 1427.0bp to feature; MODIFIER	silent_mutation	Average:59.943; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N
vg0316570538	C -> T	LOC_Os03g29150-LOC_Os03g29170	intergenic_region ; MODIFIER	silent_mutation	Average:59.943; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316570538	NA	2.52E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538	NA	3.65E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538	NA	9.46E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538	NA	2.42E-07	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538	NA	6.20E-06	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538	NA	2.80E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538	NA	2.58E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538	NA	6.76E-08	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538	NA	2.80E-07	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538	NA	2.21E-06	mr1693_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538	NA	5.67E-06	mr1736_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538	NA	1.18E-06	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538	NA	7.65E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316570538	NA	6.79E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251