\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316549393:

Variant ID: vg0316549393 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16549393
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


AGTCTAACATGCGGACTCTCATGTGTCTATGATACATAATTTAGTGGTAAATTGTTAAACGCCACATTTAAAAATGGCAGTCACGACAAACAATTAAGTA[C/T]
GAGTTCGGCGACTGAACAGGATCTCACAAAAAATTAGAGATCGAAATATTTTATATTAGTCCACTACTGAAAAACCATTTTTCTAGAGGAGAACACCGTT

Reverse complement sequence

AACGGTGTTCTCCTCTAGAAAAATGGTTTTTCAGTAGTGGACTAATATAAAATATTTCGATCTCTAATTTTTTGTGAGATCCTGTTCAGTCGCCGAACTC[G/A]
TACTTAATTGTTTGTCGTGACTGCCATTTTTAAATGTGGCGTTTAACAATTTACCACTAAATTATGTATCATAGACACATGAGAGTCCGCATGTTAGACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.70% 24.20% 0.95% 2.09% NA
All Indica  2759 95.10% 4.00% 0.25% 0.58% NA
All Japonica  1512 40.80% 52.30% 2.45% 4.43% NA
Aus  269 16.40% 78.80% 0.00% 4.83% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 1.90% 0.00% 0.22% NA
Indica III  913 95.10% 3.90% 0.11% 0.88% NA
Indica Intermediate  786 89.90% 8.40% 0.76% 0.89% NA
Temperate Japonica  767 49.80% 39.00% 4.17% 7.04% NA
Tropical Japonica  504 28.60% 69.00% 0.79% 1.59% NA
Japonica Intermediate  241 37.80% 59.80% 0.41% 2.07% NA
VI/Aromatic  96 92.70% 6.20% 0.00% 1.04% NA
Intermediate  90 67.80% 28.90% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316549393 C -> T LOC_Os03g29150.1 upstream_gene_variant ; 1961.0bp to feature; MODIFIER silent_mutation Average:47.999; most accessible tissue: Callus, score: 67.876 N N N N
vg0316549393 C -> T LOC_Os03g29150.2 upstream_gene_variant ; 1961.0bp to feature; MODIFIER silent_mutation Average:47.999; most accessible tissue: Callus, score: 67.876 N N N N
vg0316549393 C -> T LOC_Os03g29150.3 upstream_gene_variant ; 1961.0bp to feature; MODIFIER silent_mutation Average:47.999; most accessible tissue: Callus, score: 67.876 N N N N
vg0316549393 C -> T LOC_Os03g29130.1 downstream_gene_variant ; 2226.0bp to feature; MODIFIER silent_mutation Average:47.999; most accessible tissue: Callus, score: 67.876 N N N N
vg0316549393 C -> T LOC_Os03g29140.1 intron_variant ; MODIFIER silent_mutation Average:47.999; most accessible tissue: Callus, score: 67.876 N N N N
vg0316549393 C -> DEL N N silent_mutation Average:47.999; most accessible tissue: Callus, score: 67.876 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316549393 NA 4.61E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 7.20E-06 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 8.58E-06 2.79E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 5.94E-11 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 4.04E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 9.84E-07 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 1.34E-06 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 1.00E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 2.16E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 5.17E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 4.61E-06 1.06E-06 mr1470_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 2.13E-06 2.13E-06 mr1470_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 4.82E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 2.20E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 2.51E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 5.97E-07 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 1.53E-06 1.53E-06 mr1719_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 5.89E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 3.13E-06 9.70E-07 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 5.97E-07 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 7.40E-11 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 3.09E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 3.82E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 3.07E-06 3.07E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 6.53E-06 6.53E-06 mr1927_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393 NA 9.29E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251