Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316549393:

Variant ID: vg0316549393 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16549393
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

AGTCTAACATGCGGACTCTCATGTGTCTATGATACATAATTTAGTGGTAAATTGTTAAACGCCACATTTAAAAATGGCAGTCACGACAAACAATTAAGTA[C/T]
GAGTTCGGCGACTGAACAGGATCTCACAAAAAATTAGAGATCGAAATATTTTATATTAGTCCACTACTGAAAAACCATTTTTCTAGAGGAGAACACCGTT

Reverse complement sequence

AACGGTGTTCTCCTCTAGAAAAATGGTTTTTCAGTAGTGGACTAATATAAAATATTTCGATCTCTAATTTTTTGTGAGATCCTGTTCAGTCGCCGAACTC[G/A]
TACTTAATTGTTTGTCGTGACTGCCATTTTTAAATGTGGCGTTTAACAATTTACCACTAAATTATGTATCATAGACACATGAGAGTCCGCATGTTAGACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.70%	24.20%	0.95%	2.09%	NA
All Indica	2759	95.10%	4.00%	0.25%	0.58%	NA
All Japonica	1512	40.80%	52.30%	2.45%	4.43%	NA
Aus	269	16.40%	78.80%	0.00%	4.83%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.80%	1.90%	0.00%	0.22%	NA
Indica III	913	95.10%	3.90%	0.11%	0.88%	NA
Indica Intermediate	786	89.90%	8.40%	0.76%	0.89%	NA
Temperate Japonica	767	49.80%	39.00%	4.17%	7.04%	NA
Tropical Japonica	504	28.60%	69.00%	0.79%	1.59%	NA
Japonica Intermediate	241	37.80%	59.80%	0.41%	2.07%	NA
VI/Aromatic	96	92.70%	6.20%	0.00%	1.04%	NA
Intermediate	90	67.80%	28.90%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316549393	C -> T	LOC_Os03g29150.1	upstream_gene_variant ; 1961.0bp to feature; MODIFIER	silent_mutation	Average:47.999; most accessible tissue: Callus, score: 67.876	N	N	N	N
vg0316549393	C -> T	LOC_Os03g29150.2	upstream_gene_variant ; 1961.0bp to feature; MODIFIER	silent_mutation	Average:47.999; most accessible tissue: Callus, score: 67.876	N	N	N	N
vg0316549393	C -> T	LOC_Os03g29150.3	upstream_gene_variant ; 1961.0bp to feature; MODIFIER	silent_mutation	Average:47.999; most accessible tissue: Callus, score: 67.876	N	N	N	N
vg0316549393	C -> T	LOC_Os03g29130.1	downstream_gene_variant ; 2226.0bp to feature; MODIFIER	silent_mutation	Average:47.999; most accessible tissue: Callus, score: 67.876	N	N	N	N
vg0316549393	C -> T	LOC_Os03g29140.1	intron_variant ; MODIFIER	silent_mutation	Average:47.999; most accessible tissue: Callus, score: 67.876	N	N	N	N
vg0316549393	C -> DEL	N	N	silent_mutation	Average:47.999; most accessible tissue: Callus, score: 67.876	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316549393	NA	4.61E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	7.20E-06	mr1876	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	8.58E-06	2.79E-07	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	5.94E-11	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	4.04E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	9.84E-07	mr1291_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	1.34E-06	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	1.00E-07	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	2.16E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	5.17E-07	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	4.61E-06	1.06E-06	mr1470_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	2.13E-06	2.13E-06	mr1470_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	4.82E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	2.20E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	2.51E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	5.97E-07	mr1704_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	1.53E-06	1.53E-06	mr1719_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	5.89E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	3.13E-06	9.70E-07	mr1736_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	5.97E-07	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	7.40E-11	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	3.09E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	3.82E-07	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	3.07E-06	3.07E-06	mr1914_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	6.53E-06	6.53E-06	mr1927_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316549393	NA	9.29E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251