\
| Variant ID: vg0316526266 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16526266 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.10, others allele: 0.00, population size: 200. )
CAGGGACAACGAAGACTGGATCTGAATCTTCTATTTGAAGATAGAACCATCTCGCCCGCCATTTACTGCAAGAAGAGGGGCACTGGAAGGGGATGTATCA[T/C]
GACTTCAGGCCATCCCAAAGTCGGAAACCAACACACCCGGATACCTTTTTAGGTTCCATCCAGAGCAACTCGTAATAGAAACGAAACAGGTCAAGAAACG
CGTTTCTTGACCTGTTTCGTTTCTATTACGAGTTGCTCTGGATGGAACCTAAAAAGGTATCCGGGTGTGTTGGTTTCCGACTTTGGGATGGCCTGAAGTC[A/G]
TGATACATCCCCTTCCAGTGCCCCTCTTCTTGCAGTAAATGGCGGGCGAGATGGTTCTATCTTCAAATAGAAGATTCAGATCCAGTCTTCGTTGTCCCTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.30% | 29.10% | 0.85% | 11.85% | NA |
| All Indica | 2759 | 71.50% | 23.50% | 0.14% | 4.89% | NA |
| All Japonica | 1512 | 35.70% | 38.60% | 1.98% | 23.68% | NA |
| Aus | 269 | 66.20% | 11.90% | 1.49% | 20.45% | NA |
| Indica I | 595 | 58.30% | 41.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 90.50% | 7.50% | 0.22% | 1.72% | NA |
| Indica III | 913 | 71.00% | 22.10% | 0.00% | 6.90% | NA |
| Indica Intermediate | 786 | 70.90% | 20.70% | 0.25% | 8.14% | NA |
| Temperate Japonica | 767 | 11.20% | 48.50% | 3.39% | 36.90% | NA |
| Tropical Japonica | 504 | 66.50% | 25.60% | 0.00% | 7.94% | NA |
| Japonica Intermediate | 241 | 49.40% | 34.40% | 1.66% | 14.52% | NA |
| VI/Aromatic | 96 | 9.40% | 86.50% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 58.90% | 30.00% | 1.11% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316526266 | T -> C | LOC_Os03g29085.1 | downstream_gene_variant ; 3285.0bp to feature; MODIFIER | silent_mutation | Average:58.222; most accessible tissue: Minghui63 flag leaf, score: 72.907 | N | N | N | N |
| vg0316526266 | T -> C | LOC_Os03g29100.1 | intron_variant ; MODIFIER | silent_mutation | Average:58.222; most accessible tissue: Minghui63 flag leaf, score: 72.907 | N | N | N | N |
| vg0316526266 | T -> DEL | N | N | silent_mutation | Average:58.222; most accessible tissue: Minghui63 flag leaf, score: 72.907 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316526266 | NA | 3.55E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | NA | 3.14E-06 | mr1318_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | NA | 7.60E-06 | mr1381_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | 6.30E-07 | 6.28E-07 | mr1387_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | 1.39E-06 | 1.39E-06 | mr1432_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | NA | 3.60E-06 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | 2.81E-06 | 2.81E-06 | mr1459_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | NA | 2.85E-06 | mr1465_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | 7.31E-06 | 7.31E-06 | mr1719_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | NA | 9.28E-06 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | NA | 5.84E-07 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | NA | 3.16E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | NA | 2.19E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | NA | 1.88E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | NA | 9.48E-06 | mr1849_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | NA | 1.16E-06 | mr1887_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316526266 | NA | 3.00E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |