\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316523826:

Variant ID: vg0316523826 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16523826
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.29, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GCAGCTGTGGACGATGATCTCGTATACAGGCCAGCACGTGCCCTCCCGCTTATCGGCTCGACCGACGACACTCCTGCTTCAAGGCCTCGTCAATACGCTT[A/G]
CCGATACCTTCAAGCTGGGCGCAGGCCCCATTCAGCCATGAGATGTATCCGGCCGCAGATTCCTCGGGATCCCCACGAGGCACTCGGAGTTCCTTGCAAA

Reverse complement sequence

TTTGCAAGGAACTCCGAGTGCCTCGTGGGGATCCCGAGGAATCTGCGGCCGGATACATCTCATGGCTGAATGGGGCCTGCGCCCAGCTTGAAGGTATCGG[T/C]
AAGCGTATTGACGAGGCCTTGAAGCAGGAGTGTCGTCGGTCGAGCCGATAAGCGGGAGGGCACGTGCTGGCCTGTATACGAGATCATCGTCCACAGCTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 21.10% 1.08% 10.54% NA
All Indica  2759 83.40% 11.90% 0.98% 3.77% NA
All Japonica  1512 36.70% 38.30% 1.26% 23.74% NA
Aus  269 93.30% 1.10% 0.37% 5.20% NA
Indica I  595 62.00% 29.60% 1.51% 6.89% NA
Indica II  465 94.00% 3.20% 0.86% 1.94% NA
Indica III  913 90.90% 6.00% 0.33% 2.74% NA
Indica Intermediate  786 84.50% 10.40% 1.40% 3.69% NA
Temperate Japonica  767 8.30% 49.50% 1.30% 40.81% NA
Tropical Japonica  504 70.40% 22.60% 0.99% 5.95% NA
Japonica Intermediate  241 56.40% 35.30% 1.66% 6.64% NA
VI/Aromatic  96 15.60% 68.80% 2.08% 13.54% NA
Intermediate  90 67.80% 21.10% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316523826 A -> DEL LOC_Os03g29100.1 N splice_donor_variant Average:62.883; most accessible tissue: Minghui63 young leaf, score: 83.166 N N N N
vg0316523826 A -> G LOC_Os03g29100.1 splice_donor_variant&intron_variant ; HIGH splice_donor_variant Average:62.883; most accessible tissue: Minghui63 young leaf, score: 83.166 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316523826 NA 8.15E-07 mr1006_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 7.52E-06 mr1037_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 1.57E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 5.03E-06 5.03E-06 mr1432_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 6.34E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 3.32E-07 3.32E-07 mr1470_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 5.38E-07 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 5.59E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 5.83E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 5.25E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 2.73E-07 2.73E-07 mr1719_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 8.00E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 2.50E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 7.07E-07 mr1736_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 2.70E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 1.24E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 8.56E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 6.85E-07 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 NA 4.99E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 3.07E-06 3.07E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316523826 6.95E-06 6.95E-06 mr1927_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251