Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316521152:

Variant ID: vg0316521152 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16521152
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.22, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

AAGCAAAGACGTTGTCGGCCGCATTGCGAAATGGGTAGTCGAGCTAACCAAGTTTGATGTCCACTTTGTACCACGAACAGCCATCAAGTCCCAGGTTCTC[A/G]
CCGACTTCGTAGCCGATTGGACTATGCCTGAAAATTGGTTAGACAGTCAAACAGACAACGAAACATGGACAATGGCGTTCGTTGGCGCACTCAACAGCCA

Reverse complement sequence

TGGCTGTTGAGTGCGCCAACGAACGCCATTGTCCATGTTTCGTTGTCTGTTTGACTGTCTAACCAATTTTCAGGCATAGTCCAATCGGCTACGAAGTCGG[T/C]
GAGAACCTGGGACTTGATGGCTGTTCGTGGTACAAAGTGGACATCAAACTTGGTTAGCTCGACTACCCATTTCGCAATGCGGCCGACAACGTCTTTGCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.50%	32.60%	1.06%	11.83%	NA
All Indica	2759	77.50%	17.50%	1.05%	3.91%	NA
All Japonica	1512	22.80%	50.80%	0.99%	25.46%	NA
Aus	269	13.80%	65.10%	1.12%	20.07%	NA
Indica I	595	62.00%	38.00%	0.00%	0.00%	NA
Indica II	465	92.50%	5.60%	0.22%	1.72%	NA
Indica III	913	81.60%	11.60%	2.30%	4.49%	NA
Indica Intermediate	786	75.70%	15.90%	0.89%	7.51%	NA
Temperate Japonica	767	1.60%	57.40%	1.69%	39.37%	NA
Tropical Japonica	504	61.30%	30.20%	0.20%	8.33%	NA
Japonica Intermediate	241	9.50%	73.00%	0.41%	17.01%	NA
VI/Aromatic	96	9.40%	86.50%	0.00%	4.17%	NA
Intermediate	90	52.20%	35.60%	3.33%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316521152	A -> DEL	LOC_Os03g29085.1	N	frameshift_variant	Average:44.793; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg0316521152	A -> G	LOC_Os03g29085.1	missense_variant ; p.Thr504Ala; MODERATE	nonsynonymous_codon ; T504A	Average:44.793; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	benign	-0.741	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316521152	NA	2.29E-06	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316521152	NA	1.98E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316521152	NA	6.31E-06	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316521152	NA	3.36E-10	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316521152	NA	1.36E-06	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316521152	NA	2.04E-07	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316521152	NA	9.33E-06	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316521152	2.26E-06	2.26E-06	mr1541_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316521152	NA	9.89E-08	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316521152	NA	9.67E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316521152	NA	6.36E-07	mr1739_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316521152	NA	9.42E-06	mr1844_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316521152	4.92E-06	4.92E-06	mr1914_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251