\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316519407:

Variant ID: vg0316519407 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16519407
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GCAATGGGGATTCCACGAAGCGAGTTGACACCCACCGATCAACCCTTCCATGGAATCACACCTCAGTCATCGTCCAAGCCATTGGGCAAGATCATGCTTC[C/T]
TGTGACTTTCGGCCAAGCGAGCAACTTCTGAATAGAGCAGATCATGTTTGATGTCGCTGAGTTTGACACAACATACAATGCCATCATCGGGAGAACTGCA

Reverse complement sequence

TGCAGTTCTCCCGATGATGGCATTGTATGTTGTGTCAAACTCAGCGACATCAAACATGATCTGCTCTATTCAGAAGTTGCTCGCTTGGCCGAAAGTCACA[G/A]
GAAGCATGATCTTGCCCAATGGCTTGGACGATGACTGAGGTGTGATTCCATGGAAGGGTTGATCGGTGGGTGTCAACTCGCTTCGTGGAATCCCCATTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.40% 38.60% 2.43% 6.58% NA
All Indica  2759 74.30% 20.70% 1.59% 3.44% NA
All Japonica  1512 22.80% 62.40% 3.77% 10.98% NA
Aus  269 10.40% 69.90% 3.72% 15.99% NA
Indica I  595 60.20% 39.80% 0.00% 0.00% NA
Indica II  465 92.30% 6.50% 0.00% 1.29% NA
Indica III  913 75.60% 17.20% 2.08% 5.15% NA
Indica Intermediate  786 72.80% 18.70% 3.18% 5.34% NA
Temperate Japonica  767 1.60% 77.40% 5.61% 15.38% NA
Tropical Japonica  504 61.50% 31.70% 1.59% 5.16% NA
Japonica Intermediate  241 9.50% 78.80% 2.49% 9.13% NA
VI/Aromatic  96 8.30% 87.50% 0.00% 4.17% NA
Intermediate  90 50.00% 42.20% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316519407 C -> T LOC_Os03g29075.1 downstream_gene_variant ; 452.0bp to feature; MODIFIER silent_mutation Average:57.135; most accessible tissue: Minghui63 young leaf, score: 77.243 N N N N
vg0316519407 C -> T LOC_Os03g29100.1 downstream_gene_variant ; 3715.0bp to feature; MODIFIER silent_mutation Average:57.135; most accessible tissue: Minghui63 young leaf, score: 77.243 N N N N
vg0316519407 C -> T LOC_Os03g29085.1 intron_variant ; MODIFIER silent_mutation Average:57.135; most accessible tissue: Minghui63 young leaf, score: 77.243 N N N N
vg0316519407 C -> DEL N N silent_mutation Average:57.135; most accessible tissue: Minghui63 young leaf, score: 77.243 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316519407 NA 1.38E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316519407 NA 1.40E-07 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316519407 NA 7.51E-06 mr1109_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316519407 NA 1.39E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316519407 NA 5.89E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316519407 6.38E-06 3.99E-10 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316519407 NA 1.68E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316519407 4.62E-06 4.62E-06 mr1259_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316519407 NA 1.23E-08 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316519407 NA 1.49E-08 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316519407 NA 3.88E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316519407 NA 1.40E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316519407 5.60E-07 5.60E-07 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251