\
| Variant ID: vg0316519407 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16519407 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 245. )
GCAATGGGGATTCCACGAAGCGAGTTGACACCCACCGATCAACCCTTCCATGGAATCACACCTCAGTCATCGTCCAAGCCATTGGGCAAGATCATGCTTC[C/T]
TGTGACTTTCGGCCAAGCGAGCAACTTCTGAATAGAGCAGATCATGTTTGATGTCGCTGAGTTTGACACAACATACAATGCCATCATCGGGAGAACTGCA
TGCAGTTCTCCCGATGATGGCATTGTATGTTGTGTCAAACTCAGCGACATCAAACATGATCTGCTCTATTCAGAAGTTGCTCGCTTGGCCGAAAGTCACA[G/A]
GAAGCATGATCTTGCCCAATGGCTTGGACGATGACTGAGGTGTGATTCCATGGAAGGGTTGATCGGTGGGTGTCAACTCGCTTCGTGGAATCCCCATTGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.40% | 38.60% | 2.43% | 6.58% | NA |
| All Indica | 2759 | 74.30% | 20.70% | 1.59% | 3.44% | NA |
| All Japonica | 1512 | 22.80% | 62.40% | 3.77% | 10.98% | NA |
| Aus | 269 | 10.40% | 69.90% | 3.72% | 15.99% | NA |
| Indica I | 595 | 60.20% | 39.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.30% | 6.50% | 0.00% | 1.29% | NA |
| Indica III | 913 | 75.60% | 17.20% | 2.08% | 5.15% | NA |
| Indica Intermediate | 786 | 72.80% | 18.70% | 3.18% | 5.34% | NA |
| Temperate Japonica | 767 | 1.60% | 77.40% | 5.61% | 15.38% | NA |
| Tropical Japonica | 504 | 61.50% | 31.70% | 1.59% | 5.16% | NA |
| Japonica Intermediate | 241 | 9.50% | 78.80% | 2.49% | 9.13% | NA |
| VI/Aromatic | 96 | 8.30% | 87.50% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 50.00% | 42.20% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316519407 | C -> T | LOC_Os03g29075.1 | downstream_gene_variant ; 452.0bp to feature; MODIFIER | silent_mutation | Average:57.135; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
| vg0316519407 | C -> T | LOC_Os03g29100.1 | downstream_gene_variant ; 3715.0bp to feature; MODIFIER | silent_mutation | Average:57.135; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
| vg0316519407 | C -> T | LOC_Os03g29085.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.135; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
| vg0316519407 | C -> DEL | N | N | silent_mutation | Average:57.135; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316519407 | NA | 1.38E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316519407 | NA | 1.40E-07 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316519407 | NA | 7.51E-06 | mr1109_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316519407 | NA | 1.39E-06 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316519407 | NA | 5.89E-06 | mr1220_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316519407 | 6.38E-06 | 3.99E-10 | mr1235_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316519407 | NA | 1.68E-06 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316519407 | 4.62E-06 | 4.62E-06 | mr1259_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316519407 | NA | 1.23E-08 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316519407 | NA | 1.49E-08 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316519407 | NA | 3.88E-06 | mr1739_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316519407 | NA | 1.40E-07 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316519407 | 5.60E-07 | 5.60E-07 | mr1914_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |