\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316516166:

Variant ID: vg0316516166 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16516166
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.28, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAAATCAATATTTTTTTTTGAAATTTCAACTTGTCAGGGTTACGGATAAGGCATACCCTTCACCCTTGGATATATGCTATACGGCAATATGGTATATC[T/C]
GCGCGAGTACGGACGTTCTCTATATGCACTAAGGAAATTCATCACAAAGTCCACCGATGGGAAGATTCCTACCCGTATAGGACTGGGTCGTCACTGTATC

Reverse complement sequence

GATACAGTGACGACCCAGTCCTATACGGGTAGGAATCTTCCCATCGGTGGACTTTGTGATGAATTTCCTTAGTGCATATAGAGAACGTCCGTACTCGCGC[A/G]
GATATACCATATTGCCGTATAGCATATATCCAAGGGTGAAGGGTATGCCTTATCCGTAACCCTGACAAGTTGAAATTTCAAAAAAAAATATTGATTTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 32.10% 0.42% 12.95% NA
All Indica  2759 77.50% 17.10% 0.18% 5.26% NA
All Japonica  1512 22.80% 50.20% 0.93% 26.12% NA
Aus  269 14.10% 64.30% 0.37% 21.19% NA
Indica I  595 62.20% 37.80% 0.00% 0.00% NA
Indica II  465 92.30% 5.60% 0.00% 2.15% NA
Indica III  913 81.50% 11.10% 0.11% 7.34% NA
Indica Intermediate  786 75.60% 15.30% 0.51% 8.65% NA
Temperate Japonica  767 1.60% 56.20% 1.56% 40.68% NA
Tropical Japonica  504 61.50% 30.20% 0.20% 8.13% NA
Japonica Intermediate  241 9.10% 73.00% 0.41% 17.43% NA
VI/Aromatic  96 9.40% 86.50% 0.00% 4.17% NA
Intermediate  90 53.30% 34.40% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316516166 T -> C LOC_Os03g29075.1 upstream_gene_variant ; 417.0bp to feature; MODIFIER silent_mutation Average:69.896; most accessible tissue: Zhenshan97 root, score: 94.834 N N N N
vg0316516166 T -> C LOC_Os03g29085.1 upstream_gene_variant ; 2967.0bp to feature; MODIFIER silent_mutation Average:69.896; most accessible tissue: Zhenshan97 root, score: 94.834 N N N N
vg0316516166 T -> C LOC_Os03g29065.1 downstream_gene_variant ; 3148.0bp to feature; MODIFIER silent_mutation Average:69.896; most accessible tissue: Zhenshan97 root, score: 94.834 N N N N
vg0316516166 T -> C LOC_Os03g29065-LOC_Os03g29075 intergenic_region ; MODIFIER silent_mutation Average:69.896; most accessible tissue: Zhenshan97 root, score: 94.834 N N N N
vg0316516166 T -> DEL N N silent_mutation Average:69.896; most accessible tissue: Zhenshan97 root, score: 94.834 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0316516166 T C 0.02 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316516166 NA 2.56E-06 mr1222 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 9.50E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 8.44E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 9.36E-07 9.36E-07 mr1054_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 8.19E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 8.41E-06 mr1099_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 9.14E-06 9.14E-06 mr1105_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 9.08E-07 9.08E-07 mr1146_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 2.89E-06 2.89E-06 mr1168_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 5.61E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 6.01E-06 5.13E-08 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 2.19E-06 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 1.29E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 6.56E-08 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 8.51E-07 8.51E-07 mr1372_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 9.00E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 8.40E-06 8.40E-06 mr1459_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 2.62E-07 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 7.93E-07 7.93E-07 mr1547_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 4.72E-06 NA mr1566_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 1.26E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 4.13E-07 1.68E-08 mr1638_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 1.02E-06 NA mr1713_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 2.81E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 3.89E-07 5.72E-09 mr1739_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 5.17E-06 2.07E-06 mr1740_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 2.41E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 2.44E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 NA 2.39E-07 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 5.43E-07 5.43E-07 mr1907_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316516166 8.39E-07 8.39E-07 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251