\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316512384:

Variant ID: vg0316512384 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16512384
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGGCAAGCGGGACCCACACGTCAGCGAGACAAGGAGGCGGTCCACCGTGGACCGGGACCACAAGGACGGTCCATCGCCGGTCCACGGGTTGGACGGCC[C/T]
AGATCGGCCAAGCCAATCGGGCGGCTGAGGGGGAGGCAGCCGGCTGGGGCACGGGCGCGGCCGAGACCGGCCCGGCCGAGCGAAGGCGCGGCGGCGGCAC

Reverse complement sequence

GTGCCGCCGCCGCGCCTTCGCTCGGCCGGGCCGGTCTCGGCCGCGCCCGTGCCCCAGCCGGCTGCCTCCCCCTCAGCCGCCCGATTGGCTTGGCCGATCT[G/A]
GGCCGTCCAACCCGTGGACCGGCGATGGACCGTCCTTGTGGTCCCGGTCCACGGTGGACCGCCTCCTTGTCTCGCTGACGTGTGGGTCCCGCTTGCCGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 7.70% 1.35% 11.87% NA
All Indica  2759 93.60% 1.50% 1.85% 3.04% NA
All Japonica  1512 62.80% 9.60% 0.40% 27.25% NA
Aus  269 17.10% 61.70% 2.23% 18.96% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.10% 0.00% 0.22% 1.72% NA
Indica III  913 90.80% 2.50% 3.83% 2.85% NA
Indica Intermediate  786 89.40% 2.30% 1.91% 6.36% NA
Temperate Japonica  767 52.20% 4.70% 0.65% 42.50% NA
Tropical Japonica  504 87.10% 4.40% 0.00% 8.53% NA
Japonica Intermediate  241 45.60% 36.10% 0.41% 17.84% NA
VI/Aromatic  96 92.70% 3.10% 1.04% 3.12% NA
Intermediate  90 80.00% 7.80% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316512384 C -> T LOC_Os03g29065.1 upstream_gene_variant ; 290.0bp to feature; MODIFIER silent_mutation Average:77.891; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0316512384 C -> T LOC_Os03g29075.1 upstream_gene_variant ; 4199.0bp to feature; MODIFIER silent_mutation Average:77.891; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0316512384 C -> T LOC_Os03g29045-LOC_Os03g29065 intergenic_region ; MODIFIER silent_mutation Average:77.891; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0316512384 C -> DEL N N silent_mutation Average:77.891; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0316512384 C T -0.01 -0.02 0.0 -0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316512384 2.18E-07 NA mr1240 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316512384 NA 4.46E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316512384 NA 2.00E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316512384 NA 2.27E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251